ID: 1176032725

View in Genome Browser
Species Human (GRCh38)
Location 20:63021504-63021526
Sequence CTGTAGGACAGGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176032725_1176032737 16 Left 1176032725 20:63021504-63021526 CCTCCTTCCCTCCTGTCCTACAG No data
Right 1176032737 20:63021543-63021565 GGAGAGCACTCTGCCCGCTGAGG No data
1176032725_1176032734 -5 Left 1176032725 20:63021504-63021526 CCTCCTTCCCTCCTGTCCTACAG No data
Right 1176032734 20:63021522-63021544 TACAGACGGGGACCTGCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176032725 Original CRISPR CTGTAGGACAGGAGGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr