ID: 1176034480

View in Genome Browser
Species Human (GRCh38)
Location 20:63029517-63029539
Sequence GGGGGGTCCCCGCACCTTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176034480_1176034494 21 Left 1176034480 20:63029517-63029539 CCGTGAAGGTGCGGGGACCCCCC No data
Right 1176034494 20:63029561-63029583 CCTGCGTCCTGCCCACAAGGCGG No data
1176034480_1176034496 30 Left 1176034480 20:63029517-63029539 CCGTGAAGGTGCGGGGACCCCCC No data
Right 1176034496 20:63029570-63029592 TGCCCACAAGGCGGTGCTGCTGG No data
1176034480_1176034492 18 Left 1176034480 20:63029517-63029539 CCGTGAAGGTGCGGGGACCCCCC No data
Right 1176034492 20:63029558-63029580 TGTCCTGCGTCCTGCCCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176034480 Original CRISPR GGGGGGTCCCCGCACCTTCA CGG (reversed) Intergenic
No off target data available for this crispr