ID: 1176034492

View in Genome Browser
Species Human (GRCh38)
Location 20:63029558-63029580
Sequence TGTCCTGCGTCCTGCCCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176034483_1176034492 0 Left 1176034483 20:63029535-63029557 CCCCCCCAAAAGGCTTCCTTCCC No data
Right 1176034492 20:63029558-63029580 TGTCCTGCGTCCTGCCCACAAGG No data
1176034487_1176034492 -4 Left 1176034487 20:63029539-63029561 CCCAAAAGGCTTCCTTCCCTGTC No data
Right 1176034492 20:63029558-63029580 TGTCCTGCGTCCTGCCCACAAGG No data
1176034484_1176034492 -1 Left 1176034484 20:63029536-63029558 CCCCCCAAAAGGCTTCCTTCCCT No data
Right 1176034492 20:63029558-63029580 TGTCCTGCGTCCTGCCCACAAGG No data
1176034488_1176034492 -5 Left 1176034488 20:63029540-63029562 CCAAAAGGCTTCCTTCCCTGTCC No data
Right 1176034492 20:63029558-63029580 TGTCCTGCGTCCTGCCCACAAGG No data
1176034482_1176034492 1 Left 1176034482 20:63029534-63029556 CCCCCCCCAAAAGGCTTCCTTCC No data
Right 1176034492 20:63029558-63029580 TGTCCTGCGTCCTGCCCACAAGG No data
1176034480_1176034492 18 Left 1176034480 20:63029517-63029539 CCGTGAAGGTGCGGGGACCCCCC No data
Right 1176034492 20:63029558-63029580 TGTCCTGCGTCCTGCCCACAAGG No data
1176034486_1176034492 -3 Left 1176034486 20:63029538-63029560 CCCCAAAAGGCTTCCTTCCCTGT No data
Right 1176034492 20:63029558-63029580 TGTCCTGCGTCCTGCCCACAAGG No data
1176034485_1176034492 -2 Left 1176034485 20:63029537-63029559 CCCCCAAAAGGCTTCCTTCCCTG No data
Right 1176034492 20:63029558-63029580 TGTCCTGCGTCCTGCCCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176034492 Original CRISPR TGTCCTGCGTCCTGCCCACA AGG Intergenic
No off target data available for this crispr