ID: 1176034496

View in Genome Browser
Species Human (GRCh38)
Location 20:63029570-63029592
Sequence TGCCCACAAGGCGGTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176034487_1176034496 8 Left 1176034487 20:63029539-63029561 CCCAAAAGGCTTCCTTCCCTGTC No data
Right 1176034496 20:63029570-63029592 TGCCCACAAGGCGGTGCTGCTGG No data
1176034491_1176034496 -9 Left 1176034491 20:63029556-63029578 CCTGTCCTGCGTCCTGCCCACAA No data
Right 1176034496 20:63029570-63029592 TGCCCACAAGGCGGTGCTGCTGG No data
1176034482_1176034496 13 Left 1176034482 20:63029534-63029556 CCCCCCCCAAAAGGCTTCCTTCC No data
Right 1176034496 20:63029570-63029592 TGCCCACAAGGCGGTGCTGCTGG No data
1176034488_1176034496 7 Left 1176034488 20:63029540-63029562 CCAAAAGGCTTCCTTCCCTGTCC No data
Right 1176034496 20:63029570-63029592 TGCCCACAAGGCGGTGCTGCTGG No data
1176034483_1176034496 12 Left 1176034483 20:63029535-63029557 CCCCCCCAAAAGGCTTCCTTCCC No data
Right 1176034496 20:63029570-63029592 TGCCCACAAGGCGGTGCTGCTGG No data
1176034485_1176034496 10 Left 1176034485 20:63029537-63029559 CCCCCAAAAGGCTTCCTTCCCTG No data
Right 1176034496 20:63029570-63029592 TGCCCACAAGGCGGTGCTGCTGG No data
1176034486_1176034496 9 Left 1176034486 20:63029538-63029560 CCCCAAAAGGCTTCCTTCCCTGT No data
Right 1176034496 20:63029570-63029592 TGCCCACAAGGCGGTGCTGCTGG No data
1176034484_1176034496 11 Left 1176034484 20:63029536-63029558 CCCCCCAAAAGGCTTCCTTCCCT No data
Right 1176034496 20:63029570-63029592 TGCCCACAAGGCGGTGCTGCTGG No data
1176034490_1176034496 -8 Left 1176034490 20:63029555-63029577 CCCTGTCCTGCGTCCTGCCCACA No data
Right 1176034496 20:63029570-63029592 TGCCCACAAGGCGGTGCTGCTGG No data
1176034480_1176034496 30 Left 1176034480 20:63029517-63029539 CCGTGAAGGTGCGGGGACCCCCC No data
Right 1176034496 20:63029570-63029592 TGCCCACAAGGCGGTGCTGCTGG No data
1176034489_1176034496 -4 Left 1176034489 20:63029551-63029573 CCTTCCCTGTCCTGCGTCCTGCC No data
Right 1176034496 20:63029570-63029592 TGCCCACAAGGCGGTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176034496 Original CRISPR TGCCCACAAGGCGGTGCTGC TGG Intergenic
No off target data available for this crispr