ID: 1176037960

View in Genome Browser
Species Human (GRCh38)
Location 20:63049509-63049531
Sequence CAGGTACAAGAGGCCGAGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 244}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176037953_1176037960 10 Left 1176037953 20:63049476-63049498 CCCAGAAGCCTGGTAGAAAGTGA No data
Right 1176037960 20:63049509-63049531 CAGGTACAAGAGGCCGAGTGCGG 0: 1
1: 0
2: 2
3: 32
4: 244
1176037951_1176037960 28 Left 1176037951 20:63049458-63049480 CCAGCGACACAGGCAGGACCCAG No data
Right 1176037960 20:63049509-63049531 CAGGTACAAGAGGCCGAGTGCGG 0: 1
1: 0
2: 2
3: 32
4: 244
1176037954_1176037960 9 Left 1176037954 20:63049477-63049499 CCAGAAGCCTGGTAGAAAGTGAC No data
Right 1176037960 20:63049509-63049531 CAGGTACAAGAGGCCGAGTGCGG 0: 1
1: 0
2: 2
3: 32
4: 244
1176037955_1176037960 2 Left 1176037955 20:63049484-63049506 CCTGGTAGAAAGTGACCATGTGT No data
Right 1176037960 20:63049509-63049531 CAGGTACAAGAGGCCGAGTGCGG 0: 1
1: 0
2: 2
3: 32
4: 244
1176037950_1176037960 29 Left 1176037950 20:63049457-63049479 CCCAGCGACACAGGCAGGACCCA No data
Right 1176037960 20:63049509-63049531 CAGGTACAAGAGGCCGAGTGCGG 0: 1
1: 0
2: 2
3: 32
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176037960 Original CRISPR CAGGTACAAGAGGCCGAGTG CGG Intergenic
900686407 1:3950956-3950978 CAGCTACAAGAGGCTGAGCAGGG + Intergenic
901697213 1:11017314-11017336 CAGATACAGGAGGCCGAGACAGG - Intronic
902447901 1:16478682-16478704 CAGGTAGAAGAGGCCAGGTTAGG + Intergenic
902506775 1:16943819-16943841 CAGGTAGAAGAGGCCGAGCTAGG - Intronic
903527434 1:24002519-24002541 AAGATAAAAGAGGCCGGGTGTGG + Intergenic
903778922 1:25809583-25809605 CAGGGAGAGGAGGCTGAGTGTGG - Intronic
904080772 1:27871460-27871482 CAGGGAGAAGAGGCTGGGTGTGG - Intergenic
904582643 1:31557713-31557735 AAGGTAAAACAGGCCGTGTGCGG - Intergenic
905886233 1:41493563-41493585 CTGGTATAGGAGGCAGAGTGGGG + Intergenic
906888661 1:49682290-49682312 CAGGTACAGGAGGCTGAGGCAGG + Intronic
907287540 1:53391427-53391449 AAGCTCCAGGAGGCCGAGTGTGG - Intergenic
907885521 1:58589181-58589203 CAGGTACAAGAGGCAGGATGTGG - Intergenic
907980967 1:59480465-59480487 TAGGCAGAAGAGACCGAGTGAGG - Intronic
908076762 1:60528284-60528306 CAGGAACAAGAGAGAGAGTGAGG - Intergenic
909195904 1:72622810-72622832 CAGATAAAATAGGCCGGGTGTGG - Intergenic
910707578 1:90146360-90146382 AAGGAAAAAGAGGCCGGGTGCGG + Intergenic
910823921 1:91385031-91385053 GAGGTACATGTGGCCGGGTGCGG - Intronic
915650522 1:157307269-157307291 CAGGTAGAGGAGGCTGAGAGAGG + Intergenic
915777344 1:158504474-158504496 CAGGAGCAAGAGACAGAGTGAGG + Intergenic
916545214 1:165797529-165797551 CAGGCATTAGAGGCCGGGTGTGG + Intronic
918302922 1:183220327-183220349 CAGGTACAAGAGTCAGAGATGGG + Intronic
919074596 1:192798051-192798073 CAGGAACAAGAGGGAGAGGGAGG - Intergenic
919846794 1:201647853-201647875 CAGGTAAAAGAGACGGAGGGAGG - Intronic
920109528 1:203577300-203577322 CAGGGAAAAGAGGCAGAGAGGGG + Intergenic
920898990 1:210087554-210087576 CAGGTAAGAAAGGCCCAGTGAGG - Intronic
921030339 1:211330627-211330649 CAGGTGCACGGTGCCGAGTGAGG - Intronic
921709491 1:218359216-218359238 CAGGTACAAGAAACCCAGGGTGG - Intronic
922191609 1:223323605-223323627 CAGGTACAGGATGCAGGGTGAGG + Intronic
922367452 1:224879071-224879093 CAGCTACTGGAGGCTGAGTGGGG + Intergenic
922473208 1:225889079-225889101 GAGGAGCAAGAGGCAGAGTGGGG + Exonic
923064695 1:230507170-230507192 CAAATCCAAGAGGCCAAGTGGGG + Intergenic
923151973 1:231241466-231241488 CAGGGAAAAGAGGCCCAGAGCGG + Intronic
924740148 1:246790152-246790174 CAGGGACAGGAGGCCGAGGGAGG + Intergenic
1064199216 10:13270597-13270619 CAGGAACAAGAGGGAGAGTGAGG + Intergenic
1067491764 10:46714717-46714739 CAGGTACATGAGCCCGAATTTGG - Intergenic
1067602895 10:47625659-47625681 CAGGTACATGAGCCCGAATTTGG + Intergenic
1069764938 10:70848750-70848772 AAGGTACATGAGGCCAGGTGTGG - Intronic
1077051870 11:570260-570282 CAGGGAAAACAGGCCGGGTGTGG + Intergenic
1077072836 11:684926-684948 CAGGTGCAAGAGGCAGCGTGAGG + Exonic
1077606706 11:3617221-3617243 CAGGCACAGGAGACCGGGTGGGG - Intergenic
1078414739 11:11156092-11156114 CAGGTGCGAGAGGCCCAGGGAGG - Intergenic
1079378388 11:19914832-19914854 CAGGAACAACAGGCCGGGCGCGG - Intronic
1080270644 11:30447708-30447730 CAAGTAAGAAAGGCCGAGTGTGG + Intronic
1081411070 11:42759199-42759221 AAGTGACAAGAGGCCGGGTGTGG + Intergenic
1083188037 11:61029202-61029224 GAGGTAAAAGAGGCCTGGTGCGG + Intergenic
1083906410 11:65674475-65674497 AAGAAAGAAGAGGCCGAGTGCGG - Intergenic
1084955182 11:72687419-72687441 CAGGTACCAGGTGCAGAGTGTGG - Exonic
1085824188 11:79825941-79825963 CAGTTACAAGTGGCAGAGTGAGG + Intergenic
1089530807 11:119127965-119127987 CAGCTACAAGAGGCTGAGGCAGG - Intronic
1090082057 11:123620181-123620203 AAGGAAAAAGAGGCCGGGTGTGG + Intronic
1091024343 11:132128611-132128633 CAGGTACAAGAGGCTGATAAGGG + Intronic
1091131010 11:133147283-133147305 CAGGTAAAAGAAGACGAGGGAGG + Intronic
1095268747 12:40191161-40191183 AAGGTAAAAGTGGCCGGGTGCGG - Intergenic
1095774497 12:45997444-45997466 ATGGTACAACAGGCCAAGTGTGG - Intergenic
1096284288 12:50284644-50284666 CAGGTACAAGGGGCCGGGCGCGG + Intergenic
1098339575 12:69438020-69438042 CAGGTACAGGAGGCTGAGGCAGG + Intergenic
1098561645 12:71879423-71879445 CAGGTAAGGGAGGCCGAGCGAGG - Intronic
1101791728 12:107933773-107933795 CAGGAGCAAGAGGGAGAGTGGGG + Intergenic
1102920068 12:116785110-116785132 CATGTGCAAGAGGCCGAGACAGG - Intronic
1103894209 12:124262344-124262366 CAGGGAGCAGAGGCCCAGTGTGG - Intronic
1104446863 12:128841392-128841414 CAGGGACAAGAGACAGAGAGGGG - Intergenic
1104705859 12:130946846-130946868 CAGGGAGAAGAGGCCGAGATGGG + Intergenic
1105381453 13:19891251-19891273 CATGGAGAAGAGGCCGCGTGAGG + Intergenic
1105447888 13:20473423-20473445 CTGGTACCAGGGGCCGAGTCTGG - Intronic
1105525919 13:21177677-21177699 GAAGTAAAAGAGGCCGGGTGCGG + Exonic
1107230867 13:38108705-38108727 CAGGAGCAAGAGGGAGAGTGAGG + Intergenic
1108881841 13:55130209-55130231 CAGGTGTAAGAGCCCCAGTGAGG - Intergenic
1114035128 14:18617445-18617467 CTGGTACATGAGGCCCAGTGTGG + Intergenic
1114123517 14:19697571-19697593 CTGGTACATGAGGCCCAGTGTGG - Intergenic
1115805822 14:37050448-37050470 CATGCACAAGAGGCTGAGTGGGG + Intronic
1115889033 14:38006591-38006613 AAGGTATAAGTGGCTGAGTGTGG + Intronic
1119830934 14:77702006-77702028 TAGGTACTAGAGGCCGGGCGTGG + Intronic
1121316116 14:92961893-92961915 CACACACAAGAGGCCGTGTGAGG + Intronic
1122375448 14:101254020-101254042 CAGGAACAAGAGGCTGGGTGTGG - Intergenic
1122496177 14:102157148-102157170 CAGCTACAAGAGGCTGAGGTGGG + Intronic
1123164952 14:106317804-106317826 CACGTGCAAGAGGCACAGTGTGG - Intergenic
1124350224 15:28949757-28949779 CAACAACAAGAGGCCGGGTGTGG - Intronic
1125599492 15:40907485-40907507 CAGGGCCAAGGGGCTGAGTGGGG - Intergenic
1126487830 15:49202293-49202315 CAGACACAAGAGGCCAGGTGTGG - Intronic
1127038021 15:54941251-54941273 TAGGAATAAGAGGCCAAGTGGGG - Intergenic
1128147249 15:65338587-65338609 CAGGTGCAAGAGGGAGGGTGTGG + Intronic
1129741992 15:77993730-77993752 CAGATACAACAGGCCCAGGGAGG - Intronic
1129863378 15:78881828-78881850 CAGGTAAAAGAGCCTGAGTCAGG - Intronic
1131205020 15:90437151-90437173 CAGGAACAAGAGGAAGAGAGAGG + Intronic
1133142486 16:3757572-3757594 CAGGTACCACAGGCAGAGAGGGG + Intronic
1133824165 16:9262129-9262151 GAGATAGAGGAGGCCGAGTGGGG + Intergenic
1134123559 16:11601122-11601144 CAGGTGCAAAAGGAGGAGTGAGG - Intronic
1134179513 16:12036228-12036250 CAACTACAAGGAGCCGAGTGTGG - Intronic
1135306251 16:21370018-21370040 CAACTACAAGGAGCCGAGTGTGG - Intergenic
1136302993 16:29349155-29349177 CAACTACAAGGAGCCGAGTGTGG - Intergenic
1137979775 16:53059659-53059681 CAGAGACAAGAGGCAGATTGAGG - Intronic
1139182476 16:64764365-64764387 CAGCTAAAAGTGGCCGAGTTGGG - Intergenic
1142354734 16:89597073-89597095 CAGGGACAGGAGGCTGACTGTGG - Exonic
1142512998 17:409688-409710 AAGGTACAGGAGGCCGAGCACGG + Intergenic
1142640500 17:1282979-1283001 AACGTAAAAGGGGCCGAGTGTGG - Intronic
1142886205 17:2913577-2913599 CATGAACAGAAGGCCGAGTGTGG - Intronic
1143125888 17:4640711-4640733 CAGGTTCAAGAGGACGCGGGCGG + Intronic
1143483233 17:7238880-7238902 GACGTAGAAGAGGCTGAGTGAGG - Intronic
1149692906 17:58592827-58592849 TAAGTAAAACAGGCCGAGTGTGG - Intronic
1149894855 17:60421755-60421777 CAGGGACCCGAGGCCGAGGGCGG - Intronic
1150824512 17:68462843-68462865 CAAGTACAAGGGGGAGAGTGTGG + Intergenic
1151268178 17:72972738-72972760 CGGCTCCAAGAGGCCTAGTGAGG - Intronic
1152224479 17:79086293-79086315 CGGGTACCTCAGGCCGAGTGGGG + Exonic
1152845852 17:82599394-82599416 CATGAACAAGAGGCCAGGTGCGG - Intronic
1154250388 18:12739100-12739122 CAGATACATGAGGATGAGTGAGG + Intergenic
1157139750 18:45094006-45094028 TAGGTACAAGAGGCCAGGTACGG + Intergenic
1158462978 18:57663090-57663112 CAGGGACTGGAGGGCGAGTGAGG - Intronic
1159010135 18:63051236-63051258 CAGAAACAAGGGGCCGAGCGTGG + Intergenic
1161217075 19:3099890-3099912 CAGTTACAAGAGGCAGAGGTAGG - Intronic
1161431626 19:4235813-4235835 CAGTTACAAGAGGCTGAGGTGGG + Intronic
1161620666 19:5295345-5295367 CATGGACAAGAGGCCCAGAGAGG - Intronic
1161943270 19:7419068-7419090 CAGGGTACAGAGGCCGAGTGTGG - Intronic
1162524620 19:11200301-11200323 CAGGCACCTGAGGCCGGGTGGGG + Exonic
1163393093 19:17042428-17042450 AAGTCACAAGAGGCCGGGTGCGG + Intergenic
1165047880 19:33120566-33120588 AAGGTAAAAGAGGCTGGGTGCGG + Intronic
1165177109 19:33938589-33938611 CAGGGACAGGAGGCAGAATGGGG - Intergenic
1167507758 19:49880146-49880168 AAGGTACAGCAGGCCGGGTGCGG - Intronic
1168252117 19:55147177-55147199 CAGAGAGAAGAGGCCCAGTGGGG + Intronic
1168556967 19:57351488-57351510 CAAGGACAAGAGGACGTGTGTGG - Exonic
1168719272 19:58545894-58545916 CTGGTACATGAGGCTGAGGGGGG + Exonic
927067504 2:19488203-19488225 CAGGTACCAGAGGCAGAGAAAGG - Intergenic
927589280 2:24339196-24339218 GAGGTACAAGAGGCCAGGTGTGG + Intronic
929543979 2:42843793-42843815 CAGGTACATGAGGAGCAGTGAGG + Intergenic
929570875 2:43022172-43022194 CAGGGAGAAGAGGCTGAATGAGG - Intergenic
929960410 2:46492018-46492040 GAGGTACCAGAGACCAAGTGTGG + Intronic
934611410 2:95739657-95739679 CAGGTGCAAGAGAGGGAGTGTGG - Intergenic
937639174 2:124192287-124192309 CAGGGAGAAGAGGCCAACTGTGG - Intronic
938062690 2:128265371-128265393 CAGGTGCAGGAGGCTCAGTGAGG - Intronic
938184705 2:129219751-129219773 CAGGAACAAGAGTGGGAGTGAGG - Intergenic
938276123 2:130025423-130025445 CTGGTACATGAGGCCCCGTGTGG - Intergenic
938327078 2:130416180-130416202 CTGGTACATGAGGCCCCGTGTGG - Intergenic
938362861 2:130705297-130705319 CTGGTACATGAGGCCCCGTGTGG + Intergenic
938405346 2:131029842-131029864 AAAGTACAACTGGCCGAGTGTGG - Intronic
938439249 2:131311926-131311948 CTGGTACATGAGGCCCCGTGTGG + Intronic
942345419 2:174997739-174997761 AAGATACAAAAGGCCGGGTGTGG + Intronic
944554050 2:200870382-200870404 GAGGTCCTGGAGGCCGAGTGTGG - Intergenic
945525145 2:210878845-210878867 CAGTTACAAGAGGCTGAGGCAGG + Intergenic
948431927 2:237924295-237924317 CAGGTAAAAAAGGCCGGGCGCGG + Intergenic
948604207 2:239124398-239124420 CAGGCACGAGAGGCCGCGTGTGG - Intronic
1172233837 20:33356033-33356055 AAGGTAAAACAGGCCGGGTGTGG - Intergenic
1172849422 20:37950003-37950025 CAGGAGCAAGAGAGCGAGTGGGG + Intergenic
1172952711 20:38732003-38732025 CAGGGACAAGAGCCAGAGAGAGG + Intergenic
1174798581 20:53543204-53543226 ATAGTAAAAGAGGCCGAGTGTGG - Intergenic
1174857456 20:54060129-54060151 CAGCTACAAGGGGCAGAGAGAGG - Intronic
1175180546 20:57143467-57143489 CAGGTACAAGTGGCAGAGTGGGG - Intergenic
1175489876 20:59372700-59372722 CATGTAATAGAGGCCAAGTGTGG - Intergenic
1176037960 20:63049509-63049531 CAGGTACAAGAGGCCGAGTGCGG + Intergenic
1177402786 21:20627534-20627556 TAAGTTCAGGAGGCCGAGTGTGG + Intergenic
1177558219 21:22718153-22718175 CAGGGGCAAGAGGGAGAGTGGGG + Intergenic
1177974274 21:27827674-27827696 AAGGTAAATGAGGCCGGGTGTGG - Intergenic
1178283040 21:31300174-31300196 CAGGAGCAAGATACCGAGTGGGG - Intronic
1178470505 21:32888104-32888126 CAGAGACAAGAGGCAGAGAGAGG + Intergenic
1178511835 21:33211866-33211888 CAGGAGTAAGAGGCCGACTGAGG - Intergenic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1179784094 21:43719872-43719894 CAGGAAGAAGACGCCGAGTGAGG + Intronic
1180459249 22:15544492-15544514 CTGGTACATGAGGCCCAGTGTGG + Intergenic
1180706150 22:17811091-17811113 CAGGGACAGGAGGCTGAGTGGGG + Intronic
1180757067 22:18169550-18169572 CAGGTGCAAGAGACCAAGTGGGG - Intronic
1181074706 22:20367893-20367915 CAGGTGCAAGAGACCAAGTGGGG + Intronic
1181464091 22:23101552-23101574 CAGGAACAGGAGGCAGAGTGAGG - Intronic
1181674142 22:24441044-24441066 CAGGTACATGAGCCAGAGAGGGG - Exonic
1182215472 22:28713644-28713666 CTTGTACATGTGGCCGAGTGCGG - Intronic
1183432763 22:37775493-37775515 GAGGCACAAGAGGCCGGGCGCGG + Exonic
1183852947 22:40607212-40607234 CAGGTACACAAGGCCGGGTGCGG + Intronic
1184431428 22:44443426-44443448 GAGATACAAGAGGCAGAGGGCGG + Intergenic
1184599204 22:45532694-45532716 CAGGTACATGAGGCCTAGTTGGG + Intronic
1185243934 22:49763313-49763335 CAGGTACAAGAGGACCGGTACGG + Intergenic
950098915 3:10345585-10345607 CAGGGACAGGAGGCTGGGTGGGG + Intronic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
950518467 3:13482100-13482122 CAGTTACAAGAGGCGGAGTTGGG + Intronic
952283141 3:31942421-31942443 CAGCTACAAGAGGCTGAGAGAGG + Intronic
952838608 3:37625782-37625804 CAGATAAAACAGGCCCAGTGTGG + Intronic
953651691 3:44811353-44811375 AAGTTAAAAGAGGCCGGGTGCGG + Intronic
955677361 3:61462876-61462898 TAGGGACAAGAGGCCGGGTGCGG + Intergenic
959399106 3:105877492-105877514 CAAGGACAAGAGGCAGGGTGAGG + Intergenic
960692202 3:120358489-120358511 CAGGAACAAGAGGCCGGGTGTGG - Intergenic
961755655 3:129125778-129125800 CGAGTACAAGAGGCTGAGTTGGG - Intronic
962172520 3:133117058-133117080 CAGGTAAATCAGGCCGGGTGCGG - Intronic
962277703 3:134028838-134028860 CGGGCAAAAGAGCCCGAGTGCGG + Intronic
962356950 3:134703003-134703025 AAGATACATGTGGCCGAGTGCGG + Intronic
963012235 3:140781321-140781343 CAGGAACAAGAGGAGGAGAGAGG - Intergenic
963819033 3:149867553-149867575 AAGAGACAAGAGGCCGGGTGCGG - Intronic
964334843 3:155644310-155644332 CTGATTCCAGAGGCCGAGTGTGG + Intronic
964342115 3:155718630-155718652 CAGGAGCAAGAGGGTGAGTGCGG + Intronic
966683157 3:182664823-182664845 TAGGTACCTCAGGCCGAGTGCGG - Intergenic
967159543 3:186723429-186723451 CAGATACCAGAGGCTGAGCGGGG - Intronic
967834489 3:193949602-193949624 CTGGCACCAGAGGCTGAGTGTGG - Intergenic
968151375 3:196339110-196339132 CTTGAACAAGAGGCTGAGTGCGG - Intergenic
968616395 4:1579440-1579462 CTGGGACAAGGGGGCGAGTGCGG - Intergenic
968838855 4:2985706-2985728 CAGATACAGAAGGCCGGGTGTGG + Intronic
969537421 4:7765242-7765264 CAGATACAAAAGCCAGAGTGTGG - Intronic
970058502 4:12002330-12002352 TAGGTACAAGAGGCTGGGGGTGG + Intergenic
972295745 4:37736129-37736151 CATGTAAAAGAAGCCCAGTGGGG + Intergenic
972828086 4:42784954-42784976 CAGGAACAAGAGAAAGAGTGGGG - Intergenic
973559233 4:52117874-52117896 AAGGGAGAGGAGGCCGAGTGCGG + Intergenic
973603568 4:52565080-52565102 AAGATACAATAGGCCGGGTGTGG - Intergenic
974625742 4:64427381-64427403 CAGTTACAGGAGGCCGAGGTGGG - Intergenic
976626255 4:87186336-87186358 TATATAAAAGAGGCCGAGTGTGG - Intronic
977604689 4:98971778-98971800 CAGCTACATGAGGCTGAGTCAGG - Intergenic
978519481 4:109601081-109601103 AAGATACAATAGGCCGGGTGCGG - Intronic
986772228 5:10984781-10984803 AAGGCATAAGAGGCCGGGTGTGG + Intronic
988926866 5:35998944-35998966 AATGTACAATAGGCCGAGCGCGG + Intergenic
989210422 5:38853849-38853871 CAGGTTCAAGAGGTGGGGTGTGG + Intronic
989231802 5:39095572-39095594 AATGTATAAGAGGCCGGGTGTGG + Intergenic
990343815 5:54851589-54851611 CAGGGAAAAGTGGCAGAGTGTGG + Intergenic
990452617 5:55950244-55950266 CAGGGTCAAGAGGCCGGGTGCGG + Intronic
993294250 5:86114350-86114372 AAGATACAAGAGGCTGGGTGTGG - Intergenic
994941505 5:106329435-106329457 AGGGAACAAGAGGCAGAGTGAGG - Intergenic
997233413 5:132259059-132259081 CAGGTCCCTGGGGCCGAGTGAGG + Intronic
998013210 5:138711793-138711815 GAGGTAGGAGAGGCCCAGTGAGG + Intronic
998437542 5:142125102-142125124 ACAGTACAAGAGGCCGGGTGTGG - Intronic
999790927 5:154938590-154938612 TATGCACAAGAGGCCGGGTGCGG + Intergenic
1000120881 5:158196875-158196897 CAGGAACAAGGGGCTGAGGGAGG - Intergenic
1004068971 6:12279276-12279298 CAGGTAGCAGAGGCAGAGAGGGG + Intergenic
1004413902 6:15406967-15406989 AAGGTACATGAGGCCATGTGCGG + Intronic
1004625769 6:17375436-17375458 CAGGAAAAAGAGGCTGAGCGCGG - Intergenic
1005505453 6:26465404-26465426 AAGGTAAAAGAGGCTGAGTATGG + Exonic
1007277057 6:40682209-40682231 CAGGTAGAAGATGCCGTCTGTGG - Intergenic
1007500531 6:42293592-42293614 CAGGTCCAGGAGGCCAAGAGTGG - Intronic
1007722227 6:43891784-43891806 CAGGTTCAAGAGGCCAGGCGCGG - Intergenic
1008395032 6:50996162-50996184 CAGATACCAGAGGCCCAGAGAGG - Intergenic
1008584992 6:52940650-52940672 TAGCTATAAGAGGCCAAGTGTGG + Intergenic
1008622808 6:53288143-53288165 CAGGTAGATAAGGCAGAGTGAGG + Intronic
1012235133 6:96805271-96805293 CAGGAACAAGAGAGCGAGAGGGG + Intronic
1012961417 6:105625941-105625963 ATGGTACAAGAGGTCGTGTGTGG - Intergenic
1013508982 6:110827472-110827494 TAACTACAAGAGGCCGGGTGTGG + Intronic
1019386004 7:756602-756624 AAGGTACAAGGGTCCGGGTGTGG - Intronic
1021073712 7:16274335-16274357 CAGCCACAACAGGCCGGGTGTGG - Intronic
1022117927 7:27278517-27278539 CAAGTACATGAGGCTGGGTGCGG - Intergenic
1022563021 7:31369480-31369502 CAGGCACAGGATGCCGGGTGGGG + Intergenic
1023645933 7:42314943-42314965 AAGGTAAAAGAGGCAGATTGTGG + Intergenic
1025715460 7:63951768-63951790 CAGGTTCAAGAGGCTGAGGAAGG + Intergenic
1026538452 7:71259929-71259951 CAGGACCAAGAGGCTGGGTGCGG - Intronic
1026837817 7:73649895-73649917 CAGCTTCAAGGGGCCGTGTGGGG + Intergenic
1029149679 7:98470886-98470908 CAGGTACGTGTGGCCAAGTGTGG + Intergenic
1030354958 7:108531605-108531627 AAAGTAAAAGAGGCCGGGTGTGG - Intronic
1030913947 7:115289125-115289147 CAGGAACAAGAGAGTGAGTGAGG + Intergenic
1035749651 8:1987562-1987584 CAGGTTCTAGAGACCGAGGGTGG - Intronic
1038195147 8:25360404-25360426 CAGGCGCAAGAGGCCCAGTATGG + Intronic
1038277734 8:26135818-26135840 AAGGTACAAGAGGCTGGGCGTGG + Intergenic
1039821160 8:41136831-41136853 CAGGCACATGAGGGCGAGAGAGG - Intergenic
1042688255 8:71465330-71465352 AAGGAAGAAGAGGCCGGGTGTGG + Intronic
1043513282 8:80970918-80970940 CAGATACAGAAGGCTGAGTGGGG + Exonic
1045001754 8:97884492-97884514 CAGCAACAACAGGCCGAGTGTGG + Intronic
1046042046 8:108917612-108917634 CAGGTTGGAGAGGCCGGGTGCGG + Intergenic
1046996656 8:120531402-120531424 GAGGAAGAAGAGGCCGGGTGTGG + Intronic
1047380605 8:124358802-124358824 CAGAAACAAGCGGCCAAGTGAGG + Intronic
1048207682 8:132428442-132428464 CAGGGACCAGAGGCTGATTGCGG - Intronic
1048331630 8:133474666-133474688 CGGGTGCAAGAGCCCGAGGGTGG - Intronic
1048732417 8:137458245-137458267 CAGGTAGAAGAGGCTGATTTTGG + Intergenic
1049604529 8:143523105-143523127 CAGGGAGAAGAGGCCCAGTCTGG - Intronic
1050212661 9:3280290-3280312 CATGTACAAGAGGGCTAATGTGG + Intronic
1051818390 9:21135755-21135777 CAGATAAATGAGGCCCAGTGAGG + Intergenic
1052316114 9:27117925-27117947 CAGATACAATAGGCGGAGTCAGG + Intronic
1055602308 9:77932614-77932636 CAGGTACAAGAGGGTCAGTGTGG + Intronic
1057585190 9:96322633-96322655 CAGGCAAAAGAGGAAGAGTGGGG + Intronic
1057839349 9:98473005-98473027 CAGGTACAAGAGGCTCAGAGAGG + Intronic
1057955120 9:99401202-99401224 TCTGTACCAGAGGCCGAGTGTGG - Intergenic
1058260596 9:102825249-102825271 AAGCTACAAGAGACCGAGTGTGG + Intergenic
1059407953 9:114113543-114113565 TAGGTACATGAGGAGGAGTGTGG + Intergenic
1062307395 9:135916368-135916390 CAGGAATAAGAGGCCGGGTGCGG + Intergenic
1062324007 9:136003956-136003978 CAGGTAGAGGAGGCCTAGGGTGG - Intergenic
1062410965 9:136424106-136424128 CTTGTACAAGAGGCCGGGCGCGG + Intergenic
1062700974 9:137902809-137902831 CTGGTACAAGATGCAGGGTGAGG + Intronic
1187739608 X:22341374-22341396 AAGTGACAGGAGGCCGAGTGGGG + Intergenic
1188045347 X:25420020-25420042 CAGGAACAAGAGACAGAGTGAGG - Intergenic
1188217584 X:27497855-27497877 CAGAAAGCAGAGGCCGAGTGCGG - Intergenic
1188652489 X:32649262-32649284 AAGGTGGAAGAGGCCGGGTGCGG + Intronic
1188977301 X:36690859-36690881 CAGGTACAAAAGGGTGAGTGTGG - Intergenic
1189283170 X:39833452-39833474 CAGGTCCAAGGGGCCGACTCAGG + Intergenic
1190482975 X:50896150-50896172 CCGGCACAAGAGGCCTAATGTGG + Intergenic
1190775901 X:53552085-53552107 AAGGTAGAAGTGGCAGAGTGGGG + Intronic
1190798532 X:53767427-53767449 CAAATTCAAAAGGCCGAGTGTGG + Intergenic
1192691864 X:73373202-73373224 CTGGTCCAAGAGCCCCAGTGGGG + Intergenic
1194017075 X:88636212-88636234 CAGGAACAAGAGGGTGAGAGGGG - Intergenic
1196412410 X:115433986-115434008 CAGTCACAAGAGGCTGATTGAGG - Intergenic
1197397541 X:125945523-125945545 CAGGAGCAAGAGGGAGAGTGGGG + Intergenic
1198386424 X:136133476-136133498 AAGATACAGGAGGCTGAGTGTGG + Intergenic
1198464485 X:136892505-136892527 GAGTTACAAGGGGCCAAGTGTGG + Intergenic