ID: 1176042373

View in Genome Browser
Species Human (GRCh38)
Location 20:63072333-63072355
Sequence CCGCGCCCCGCTGCTGCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176042373_1176042384 3 Left 1176042373 20:63072333-63072355 CCGGGGGCAGCAGCGGGGCGCGG No data
Right 1176042384 20:63072359-63072381 GGAGGGAGGCCCGGCGGGAACGG No data
1176042373_1176042383 -2 Left 1176042373 20:63072333-63072355 CCGGGGGCAGCAGCGGGGCGCGG No data
Right 1176042383 20:63072354-63072376 GGGGCGGAGGGAGGCCCGGCGGG No data
1176042373_1176042381 -6 Left 1176042373 20:63072333-63072355 CCGGGGGCAGCAGCGGGGCGCGG No data
Right 1176042381 20:63072350-63072372 GCGCGGGGCGGAGGGAGGCCCGG No data
1176042373_1176042382 -3 Left 1176042373 20:63072333-63072355 CCGGGGGCAGCAGCGGGGCGCGG No data
Right 1176042382 20:63072353-63072375 CGGGGCGGAGGGAGGCCCGGCGG No data
1176042373_1176042385 4 Left 1176042373 20:63072333-63072355 CCGGGGGCAGCAGCGGGGCGCGG No data
Right 1176042385 20:63072360-63072382 GAGGGAGGCCCGGCGGGAACGGG No data
1176042373_1176042390 30 Left 1176042373 20:63072333-63072355 CCGGGGGCAGCAGCGGGGCGCGG No data
Right 1176042390 20:63072386-63072408 CCCCTTTGCACCCACAGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176042373 Original CRISPR CCGCGCCCCGCTGCTGCCCC CGG (reversed) Intergenic
No off target data available for this crispr