ID: 1176042396

View in Genome Browser
Species Human (GRCh38)
Location 20:63072403-63072425
Sequence GCTGAGACCTCGGCGTTCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176042396_1176042414 30 Left 1176042396 20:63072403-63072425 CCGTGGAACGCCGAGGTCTCAGC No data
Right 1176042414 20:63072456-63072478 AAGGGCAGTGCTGGGGACGCGGG No data
1176042396_1176042409 23 Left 1176042396 20:63072403-63072425 CCGTGGAACGCCGAGGTCTCAGC No data
Right 1176042409 20:63072449-63072471 ACCCCGCAAGGGCAGTGCTGGGG No data
1176042396_1176042403 12 Left 1176042396 20:63072403-63072425 CCGTGGAACGCCGAGGTCTCAGC No data
Right 1176042403 20:63072438-63072460 CGCGCCCCGAGACCCCGCAAGGG No data
1176042396_1176042402 11 Left 1176042396 20:63072403-63072425 CCGTGGAACGCCGAGGTCTCAGC No data
Right 1176042402 20:63072437-63072459 GCGCGCCCCGAGACCCCGCAAGG No data
1176042396_1176042408 22 Left 1176042396 20:63072403-63072425 CCGTGGAACGCCGAGGTCTCAGC No data
Right 1176042408 20:63072448-63072470 GACCCCGCAAGGGCAGTGCTGGG No data
1176042396_1176042407 21 Left 1176042396 20:63072403-63072425 CCGTGGAACGCCGAGGTCTCAGC No data
Right 1176042407 20:63072447-63072469 AGACCCCGCAAGGGCAGTGCTGG No data
1176042396_1176042413 29 Left 1176042396 20:63072403-63072425 CCGTGGAACGCCGAGGTCTCAGC No data
Right 1176042413 20:63072455-63072477 CAAGGGCAGTGCTGGGGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176042396 Original CRISPR GCTGAGACCTCGGCGTTCCA CGG (reversed) Intergenic