ID: 1176042397

View in Genome Browser
Species Human (GRCh38)
Location 20:63072413-63072435
Sequence CCGTAGGGGAGCTGAGACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176042397_1176042413 19 Left 1176042397 20:63072413-63072435 CCGAGGTCTCAGCTCCCCTACGG No data
Right 1176042413 20:63072455-63072477 CAAGGGCAGTGCTGGGGACGCGG No data
1176042397_1176042409 13 Left 1176042397 20:63072413-63072435 CCGAGGTCTCAGCTCCCCTACGG No data
Right 1176042409 20:63072449-63072471 ACCCCGCAAGGGCAGTGCTGGGG No data
1176042397_1176042415 21 Left 1176042397 20:63072413-63072435 CCGAGGTCTCAGCTCCCCTACGG No data
Right 1176042415 20:63072457-63072479 AGGGCAGTGCTGGGGACGCGGGG No data
1176042397_1176042414 20 Left 1176042397 20:63072413-63072435 CCGAGGTCTCAGCTCCCCTACGG No data
Right 1176042414 20:63072456-63072478 AAGGGCAGTGCTGGGGACGCGGG No data
1176042397_1176042403 2 Left 1176042397 20:63072413-63072435 CCGAGGTCTCAGCTCCCCTACGG No data
Right 1176042403 20:63072438-63072460 CGCGCCCCGAGACCCCGCAAGGG No data
1176042397_1176042402 1 Left 1176042397 20:63072413-63072435 CCGAGGTCTCAGCTCCCCTACGG No data
Right 1176042402 20:63072437-63072459 GCGCGCCCCGAGACCCCGCAAGG No data
1176042397_1176042407 11 Left 1176042397 20:63072413-63072435 CCGAGGTCTCAGCTCCCCTACGG No data
Right 1176042407 20:63072447-63072469 AGACCCCGCAAGGGCAGTGCTGG No data
1176042397_1176042408 12 Left 1176042397 20:63072413-63072435 CCGAGGTCTCAGCTCCCCTACGG No data
Right 1176042408 20:63072448-63072470 GACCCCGCAAGGGCAGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176042397 Original CRISPR CCGTAGGGGAGCTGAGACCT CGG (reversed) Intergenic