ID: 1176042399

View in Genome Browser
Species Human (GRCh38)
Location 20:63072427-63072449
Sequence TCTCGGGGCGCGCGCCGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176042399_1176042418 30 Left 1176042399 20:63072427-63072449 CCCCTACGGCGCGCGCCCCGAGA No data
Right 1176042418 20:63072480-63072502 CCGAGACTCGAGGACGCCCGAGG No data
1176042399_1176042407 -3 Left 1176042399 20:63072427-63072449 CCCCTACGGCGCGCGCCCCGAGA No data
Right 1176042407 20:63072447-63072469 AGACCCCGCAAGGGCAGTGCTGG No data
1176042399_1176042415 7 Left 1176042399 20:63072427-63072449 CCCCTACGGCGCGCGCCCCGAGA No data
Right 1176042415 20:63072457-63072479 AGGGCAGTGCTGGGGACGCGGGG No data
1176042399_1176042414 6 Left 1176042399 20:63072427-63072449 CCCCTACGGCGCGCGCCCCGAGA No data
Right 1176042414 20:63072456-63072478 AAGGGCAGTGCTGGGGACGCGGG No data
1176042399_1176042416 20 Left 1176042399 20:63072427-63072449 CCCCTACGGCGCGCGCCCCGAGA No data
Right 1176042416 20:63072470-63072492 GGACGCGGGGCCGAGACTCGAGG No data
1176042399_1176042413 5 Left 1176042399 20:63072427-63072449 CCCCTACGGCGCGCGCCCCGAGA No data
Right 1176042413 20:63072455-63072477 CAAGGGCAGTGCTGGGGACGCGG No data
1176042399_1176042409 -1 Left 1176042399 20:63072427-63072449 CCCCTACGGCGCGCGCCCCGAGA No data
Right 1176042409 20:63072449-63072471 ACCCCGCAAGGGCAGTGCTGGGG No data
1176042399_1176042408 -2 Left 1176042399 20:63072427-63072449 CCCCTACGGCGCGCGCCCCGAGA No data
Right 1176042408 20:63072448-63072470 GACCCCGCAAGGGCAGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176042399 Original CRISPR TCTCGGGGCGCGCGCCGTAG GGG (reversed) Intergenic