ID: 1176042400

View in Genome Browser
Species Human (GRCh38)
Location 20:63072428-63072450
Sequence GTCTCGGGGCGCGCGCCGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176042400_1176042409 -2 Left 1176042400 20:63072428-63072450 CCCTACGGCGCGCGCCCCGAGAC No data
Right 1176042409 20:63072449-63072471 ACCCCGCAAGGGCAGTGCTGGGG No data
1176042400_1176042408 -3 Left 1176042400 20:63072428-63072450 CCCTACGGCGCGCGCCCCGAGAC No data
Right 1176042408 20:63072448-63072470 GACCCCGCAAGGGCAGTGCTGGG No data
1176042400_1176042415 6 Left 1176042400 20:63072428-63072450 CCCTACGGCGCGCGCCCCGAGAC No data
Right 1176042415 20:63072457-63072479 AGGGCAGTGCTGGGGACGCGGGG No data
1176042400_1176042407 -4 Left 1176042400 20:63072428-63072450 CCCTACGGCGCGCGCCCCGAGAC No data
Right 1176042407 20:63072447-63072469 AGACCCCGCAAGGGCAGTGCTGG No data
1176042400_1176042416 19 Left 1176042400 20:63072428-63072450 CCCTACGGCGCGCGCCCCGAGAC No data
Right 1176042416 20:63072470-63072492 GGACGCGGGGCCGAGACTCGAGG No data
1176042400_1176042414 5 Left 1176042400 20:63072428-63072450 CCCTACGGCGCGCGCCCCGAGAC No data
Right 1176042414 20:63072456-63072478 AAGGGCAGTGCTGGGGACGCGGG No data
1176042400_1176042413 4 Left 1176042400 20:63072428-63072450 CCCTACGGCGCGCGCCCCGAGAC No data
Right 1176042413 20:63072455-63072477 CAAGGGCAGTGCTGGGGACGCGG No data
1176042400_1176042418 29 Left 1176042400 20:63072428-63072450 CCCTACGGCGCGCGCCCCGAGAC No data
Right 1176042418 20:63072480-63072502 CCGAGACTCGAGGACGCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176042400 Original CRISPR GTCTCGGGGCGCGCGCCGTA GGG (reversed) Intergenic