ID: 1176042401

View in Genome Browser
Species Human (GRCh38)
Location 20:63072429-63072451
Sequence GGTCTCGGGGCGCGCGCCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176042401_1176042409 -3 Left 1176042401 20:63072429-63072451 CCTACGGCGCGCGCCCCGAGACC No data
Right 1176042409 20:63072449-63072471 ACCCCGCAAGGGCAGTGCTGGGG No data
1176042401_1176042418 28 Left 1176042401 20:63072429-63072451 CCTACGGCGCGCGCCCCGAGACC No data
Right 1176042418 20:63072480-63072502 CCGAGACTCGAGGACGCCCGAGG No data
1176042401_1176042413 3 Left 1176042401 20:63072429-63072451 CCTACGGCGCGCGCCCCGAGACC No data
Right 1176042413 20:63072455-63072477 CAAGGGCAGTGCTGGGGACGCGG No data
1176042401_1176042408 -4 Left 1176042401 20:63072429-63072451 CCTACGGCGCGCGCCCCGAGACC No data
Right 1176042408 20:63072448-63072470 GACCCCGCAAGGGCAGTGCTGGG No data
1176042401_1176042414 4 Left 1176042401 20:63072429-63072451 CCTACGGCGCGCGCCCCGAGACC No data
Right 1176042414 20:63072456-63072478 AAGGGCAGTGCTGGGGACGCGGG No data
1176042401_1176042415 5 Left 1176042401 20:63072429-63072451 CCTACGGCGCGCGCCCCGAGACC No data
Right 1176042415 20:63072457-63072479 AGGGCAGTGCTGGGGACGCGGGG No data
1176042401_1176042416 18 Left 1176042401 20:63072429-63072451 CCTACGGCGCGCGCCCCGAGACC No data
Right 1176042416 20:63072470-63072492 GGACGCGGGGCCGAGACTCGAGG No data
1176042401_1176042407 -5 Left 1176042401 20:63072429-63072451 CCTACGGCGCGCGCCCCGAGACC No data
Right 1176042407 20:63072447-63072469 AGACCCCGCAAGGGCAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176042401 Original CRISPR GGTCTCGGGGCGCGCGCCGT AGG (reversed) Intergenic