ID: 1176042404

View in Genome Browser
Species Human (GRCh38)
Location 20:63072442-63072464
Sequence ACTGCCCTTGCGGGGTCTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176042404_1176042415 -8 Left 1176042404 20:63072442-63072464 CCCCGAGACCCCGCAAGGGCAGT No data
Right 1176042415 20:63072457-63072479 AGGGCAGTGCTGGGGACGCGGGG No data
1176042404_1176042422 25 Left 1176042404 20:63072442-63072464 CCCCGAGACCCCGCAAGGGCAGT No data
Right 1176042422 20:63072490-63072512 AGGACGCCCGAGGCCGGGACGGG No data
1176042404_1176042419 19 Left 1176042404 20:63072442-63072464 CCCCGAGACCCCGCAAGGGCAGT No data
Right 1176042419 20:63072484-63072506 GACTCGAGGACGCCCGAGGCCGG No data
1176042404_1176042416 5 Left 1176042404 20:63072442-63072464 CCCCGAGACCCCGCAAGGGCAGT No data
Right 1176042416 20:63072470-63072492 GGACGCGGGGCCGAGACTCGAGG No data
1176042404_1176042418 15 Left 1176042404 20:63072442-63072464 CCCCGAGACCCCGCAAGGGCAGT No data
Right 1176042418 20:63072480-63072502 CCGAGACTCGAGGACGCCCGAGG No data
1176042404_1176042423 26 Left 1176042404 20:63072442-63072464 CCCCGAGACCCCGCAAGGGCAGT No data
Right 1176042423 20:63072491-63072513 GGACGCCCGAGGCCGGGACGGGG No data
1176042404_1176042413 -10 Left 1176042404 20:63072442-63072464 CCCCGAGACCCCGCAAGGGCAGT No data
Right 1176042413 20:63072455-63072477 CAAGGGCAGTGCTGGGGACGCGG No data
1176042404_1176042420 20 Left 1176042404 20:63072442-63072464 CCCCGAGACCCCGCAAGGGCAGT No data
Right 1176042420 20:63072485-63072507 ACTCGAGGACGCCCGAGGCCGGG No data
1176042404_1176042421 24 Left 1176042404 20:63072442-63072464 CCCCGAGACCCCGCAAGGGCAGT No data
Right 1176042421 20:63072489-63072511 GAGGACGCCCGAGGCCGGGACGG No data
1176042404_1176042414 -9 Left 1176042404 20:63072442-63072464 CCCCGAGACCCCGCAAGGGCAGT No data
Right 1176042414 20:63072456-63072478 AAGGGCAGTGCTGGGGACGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176042404 Original CRISPR ACTGCCCTTGCGGGGTCTCG GGG (reversed) Intergenic
No off target data available for this crispr