ID: 1176042406

View in Genome Browser
Species Human (GRCh38)
Location 20:63072444-63072466
Sequence GCACTGCCCTTGCGGGGTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176042406_1176042427 30 Left 1176042406 20:63072444-63072466 CCGAGACCCCGCAAGGGCAGTGC No data
Right 1176042427 20:63072497-63072519 CCGAGGCCGGGACGGGGTGTGGG No data
1176042406_1176042425 29 Left 1176042406 20:63072444-63072466 CCGAGACCCCGCAAGGGCAGTGC No data
Right 1176042425 20:63072496-63072518 CCCGAGGCCGGGACGGGGTGTGG No data
1176042406_1176042422 23 Left 1176042406 20:63072444-63072466 CCGAGACCCCGCAAGGGCAGTGC No data
Right 1176042422 20:63072490-63072512 AGGACGCCCGAGGCCGGGACGGG No data
1176042406_1176042423 24 Left 1176042406 20:63072444-63072466 CCGAGACCCCGCAAGGGCAGTGC No data
Right 1176042423 20:63072491-63072513 GGACGCCCGAGGCCGGGACGGGG No data
1176042406_1176042418 13 Left 1176042406 20:63072444-63072466 CCGAGACCCCGCAAGGGCAGTGC No data
Right 1176042418 20:63072480-63072502 CCGAGACTCGAGGACGCCCGAGG No data
1176042406_1176042421 22 Left 1176042406 20:63072444-63072466 CCGAGACCCCGCAAGGGCAGTGC No data
Right 1176042421 20:63072489-63072511 GAGGACGCCCGAGGCCGGGACGG No data
1176042406_1176042419 17 Left 1176042406 20:63072444-63072466 CCGAGACCCCGCAAGGGCAGTGC No data
Right 1176042419 20:63072484-63072506 GACTCGAGGACGCCCGAGGCCGG No data
1176042406_1176042420 18 Left 1176042406 20:63072444-63072466 CCGAGACCCCGCAAGGGCAGTGC No data
Right 1176042420 20:63072485-63072507 ACTCGAGGACGCCCGAGGCCGGG No data
1176042406_1176042416 3 Left 1176042406 20:63072444-63072466 CCGAGACCCCGCAAGGGCAGTGC No data
Right 1176042416 20:63072470-63072492 GGACGCGGGGCCGAGACTCGAGG No data
1176042406_1176042415 -10 Left 1176042406 20:63072444-63072466 CCGAGACCCCGCAAGGGCAGTGC No data
Right 1176042415 20:63072457-63072479 AGGGCAGTGCTGGGGACGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176042406 Original CRISPR GCACTGCCCTTGCGGGGTCT CGG (reversed) Intergenic