ID: 1176042413

View in Genome Browser
Species Human (GRCh38)
Location 20:63072455-63072477
Sequence CAAGGGCAGTGCTGGGGACG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176042400_1176042413 4 Left 1176042400 20:63072428-63072450 CCCTACGGCGCGCGCCCCGAGAC No data
Right 1176042413 20:63072455-63072477 CAAGGGCAGTGCTGGGGACGCGG No data
1176042401_1176042413 3 Left 1176042401 20:63072429-63072451 CCTACGGCGCGCGCCCCGAGACC No data
Right 1176042413 20:63072455-63072477 CAAGGGCAGTGCTGGGGACGCGG No data
1176042397_1176042413 19 Left 1176042397 20:63072413-63072435 CCGAGGTCTCAGCTCCCCTACGG No data
Right 1176042413 20:63072455-63072477 CAAGGGCAGTGCTGGGGACGCGG No data
1176042399_1176042413 5 Left 1176042399 20:63072427-63072449 CCCCTACGGCGCGCGCCCCGAGA No data
Right 1176042413 20:63072455-63072477 CAAGGGCAGTGCTGGGGACGCGG No data
1176042396_1176042413 29 Left 1176042396 20:63072403-63072425 CCGTGGAACGCCGAGGTCTCAGC No data
Right 1176042413 20:63072455-63072477 CAAGGGCAGTGCTGGGGACGCGG No data
1176042404_1176042413 -10 Left 1176042404 20:63072442-63072464 CCCCGAGACCCCGCAAGGGCAGT No data
Right 1176042413 20:63072455-63072477 CAAGGGCAGTGCTGGGGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176042413 Original CRISPR CAAGGGCAGTGCTGGGGACG CGG Intergenic