ID: 1176042418

View in Genome Browser
Species Human (GRCh38)
Location 20:63072480-63072502
Sequence CCGAGACTCGAGGACGCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176042412_1176042418 5 Left 1176042412 20:63072452-63072474 CCGCAAGGGCAGTGCTGGGGACG No data
Right 1176042418 20:63072480-63072502 CCGAGACTCGAGGACGCCCGAGG No data
1176042410_1176042418 7 Left 1176042410 20:63072450-63072472 CCCCGCAAGGGCAGTGCTGGGGA No data
Right 1176042418 20:63072480-63072502 CCGAGACTCGAGGACGCCCGAGG No data
1176042399_1176042418 30 Left 1176042399 20:63072427-63072449 CCCCTACGGCGCGCGCCCCGAGA No data
Right 1176042418 20:63072480-63072502 CCGAGACTCGAGGACGCCCGAGG No data
1176042406_1176042418 13 Left 1176042406 20:63072444-63072466 CCGAGACCCCGCAAGGGCAGTGC No data
Right 1176042418 20:63072480-63072502 CCGAGACTCGAGGACGCCCGAGG No data
1176042405_1176042418 14 Left 1176042405 20:63072443-63072465 CCCGAGACCCCGCAAGGGCAGTG No data
Right 1176042418 20:63072480-63072502 CCGAGACTCGAGGACGCCCGAGG No data
1176042411_1176042418 6 Left 1176042411 20:63072451-63072473 CCCGCAAGGGCAGTGCTGGGGAC No data
Right 1176042418 20:63072480-63072502 CCGAGACTCGAGGACGCCCGAGG No data
1176042404_1176042418 15 Left 1176042404 20:63072442-63072464 CCCCGAGACCCCGCAAGGGCAGT No data
Right 1176042418 20:63072480-63072502 CCGAGACTCGAGGACGCCCGAGG No data
1176042401_1176042418 28 Left 1176042401 20:63072429-63072451 CCTACGGCGCGCGCCCCGAGACC No data
Right 1176042418 20:63072480-63072502 CCGAGACTCGAGGACGCCCGAGG No data
1176042400_1176042418 29 Left 1176042400 20:63072428-63072450 CCCTACGGCGCGCGCCCCGAGAC No data
Right 1176042418 20:63072480-63072502 CCGAGACTCGAGGACGCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176042418 Original CRISPR CCGAGACTCGAGGACGCCCG AGG Intergenic