ID: 1176042419

View in Genome Browser
Species Human (GRCh38)
Location 20:63072484-63072506
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176042404_1176042419 19 Left 1176042404 20:63072442-63072464 CCCCGAGACCCCGCAAGGGCAGT No data
Right 1176042419 20:63072484-63072506 GACTCGAGGACGCCCGAGGCCGG No data
1176042406_1176042419 17 Left 1176042406 20:63072444-63072466 CCGAGACCCCGCAAGGGCAGTGC No data
Right 1176042419 20:63072484-63072506 GACTCGAGGACGCCCGAGGCCGG No data
1176042411_1176042419 10 Left 1176042411 20:63072451-63072473 CCCGCAAGGGCAGTGCTGGGGAC No data
Right 1176042419 20:63072484-63072506 GACTCGAGGACGCCCGAGGCCGG No data
1176042412_1176042419 9 Left 1176042412 20:63072452-63072474 CCGCAAGGGCAGTGCTGGGGACG No data
Right 1176042419 20:63072484-63072506 GACTCGAGGACGCCCGAGGCCGG No data
1176042410_1176042419 11 Left 1176042410 20:63072450-63072472 CCCCGCAAGGGCAGTGCTGGGGA No data
Right 1176042419 20:63072484-63072506 GACTCGAGGACGCCCGAGGCCGG No data
1176042405_1176042419 18 Left 1176042405 20:63072443-63072465 CCCGAGACCCCGCAAGGGCAGTG No data
Right 1176042419 20:63072484-63072506 GACTCGAGGACGCCCGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176042419 Original CRISPR GACTCGAGGACGCCCGAGGC CGG Intergenic