ID: 1176042421

View in Genome Browser
Species Human (GRCh38)
Location 20:63072489-63072511
Sequence GAGGACGCCCGAGGCCGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176042411_1176042421 15 Left 1176042411 20:63072451-63072473 CCCGCAAGGGCAGTGCTGGGGAC No data
Right 1176042421 20:63072489-63072511 GAGGACGCCCGAGGCCGGGACGG No data
1176042404_1176042421 24 Left 1176042404 20:63072442-63072464 CCCCGAGACCCCGCAAGGGCAGT No data
Right 1176042421 20:63072489-63072511 GAGGACGCCCGAGGCCGGGACGG No data
1176042412_1176042421 14 Left 1176042412 20:63072452-63072474 CCGCAAGGGCAGTGCTGGGGACG No data
Right 1176042421 20:63072489-63072511 GAGGACGCCCGAGGCCGGGACGG No data
1176042406_1176042421 22 Left 1176042406 20:63072444-63072466 CCGAGACCCCGCAAGGGCAGTGC No data
Right 1176042421 20:63072489-63072511 GAGGACGCCCGAGGCCGGGACGG No data
1176042410_1176042421 16 Left 1176042410 20:63072450-63072472 CCCCGCAAGGGCAGTGCTGGGGA No data
Right 1176042421 20:63072489-63072511 GAGGACGCCCGAGGCCGGGACGG No data
1176042405_1176042421 23 Left 1176042405 20:63072443-63072465 CCCGAGACCCCGCAAGGGCAGTG No data
Right 1176042421 20:63072489-63072511 GAGGACGCCCGAGGCCGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176042421 Original CRISPR GAGGACGCCCGAGGCCGGGA CGG Intergenic