ID: 1176044514

View in Genome Browser
Species Human (GRCh38)
Location 20:63085418-63085440
Sequence CAGGAACAGCAGAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176044508_1176044514 -5 Left 1176044508 20:63085400-63085422 CCGGAGCCACTTGGAGCTCAGGA No data
Right 1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG No data
1176044500_1176044514 24 Left 1176044500 20:63085371-63085393 CCAGCACCTTCCCTGACGCTCTG No data
Right 1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG No data
1176044504_1176044514 13 Left 1176044504 20:63085382-63085404 CCTGACGCTCTGCTGAGCCCGGA No data
Right 1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG No data
1176044502_1176044514 14 Left 1176044502 20:63085381-63085403 CCCTGACGCTCTGCTGAGCCCGG No data
Right 1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG No data
1176044501_1176044514 18 Left 1176044501 20:63085377-63085399 CCTTCCCTGACGCTCTGCTGAGC No data
Right 1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG No data
1176044506_1176044514 -4 Left 1176044506 20:63085399-63085421 CCCGGAGCCACTTGGAGCTCAGG No data
Right 1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG No data
1176044499_1176044514 25 Left 1176044499 20:63085370-63085392 CCCAGCACCTTCCCTGACGCTCT No data
Right 1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176044514 Original CRISPR CAGGAACAGCAGAGGGAGGG AGG Intergenic
No off target data available for this crispr