ID: 1176044846

View in Genome Browser
Species Human (GRCh38)
Location 20:63087219-63087241
Sequence GAGCTCTGGATGCCACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176044846_1176044853 30 Left 1176044846 20:63087219-63087241 CCTGTCTGTGGCATCCAGAGCTC No data
Right 1176044853 20:63087272-63087294 GAGTGAGGCACTGATTCTTAAGG No data
1176044846_1176044851 15 Left 1176044846 20:63087219-63087241 CCTGTCTGTGGCATCCAGAGCTC No data
Right 1176044851 20:63087257-63087279 TGCAAACACCGGGCTGAGTGAGG No data
1176044846_1176044849 5 Left 1176044846 20:63087219-63087241 CCTGTCTGTGGCATCCAGAGCTC No data
Right 1176044849 20:63087247-63087269 GATTGCCAAGTGCAAACACCGGG No data
1176044846_1176044848 4 Left 1176044846 20:63087219-63087241 CCTGTCTGTGGCATCCAGAGCTC No data
Right 1176044848 20:63087246-63087268 TGATTGCCAAGTGCAAACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176044846 Original CRISPR GAGCTCTGGATGCCACAGAC AGG (reversed) Intergenic
No off target data available for this crispr