ID: 1176046040

View in Genome Browser
Species Human (GRCh38)
Location 20:63093093-63093115
Sequence GCACCCATGACAGCTTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176046040_1176046044 -4 Left 1176046040 20:63093093-63093115 CCCACAGAAGCTGTCATGGGTGC No data
Right 1176046044 20:63093112-63093134 GTGCTGTGTACCCCACAGGGCGG No data
1176046040_1176046047 6 Left 1176046040 20:63093093-63093115 CCCACAGAAGCTGTCATGGGTGC No data
Right 1176046047 20:63093122-63093144 CCCCACAGGGCGGGAGAGAAAGG No data
1176046040_1176046042 -8 Left 1176046040 20:63093093-63093115 CCCACAGAAGCTGTCATGGGTGC No data
Right 1176046042 20:63093108-63093130 ATGGGTGCTGTGTACCCCACAGG No data
1176046040_1176046043 -7 Left 1176046040 20:63093093-63093115 CCCACAGAAGCTGTCATGGGTGC No data
Right 1176046043 20:63093109-63093131 TGGGTGCTGTGTACCCCACAGGG No data
1176046040_1176046050 16 Left 1176046040 20:63093093-63093115 CCCACAGAAGCTGTCATGGGTGC No data
Right 1176046050 20:63093132-63093154 CGGGAGAGAAAGGTGTGTCCAGG No data
1176046040_1176046045 -3 Left 1176046040 20:63093093-63093115 CCCACAGAAGCTGTCATGGGTGC No data
Right 1176046045 20:63093113-63093135 TGCTGTGTACCCCACAGGGCGGG No data
1176046040_1176046051 27 Left 1176046040 20:63093093-63093115 CCCACAGAAGCTGTCATGGGTGC No data
Right 1176046051 20:63093143-63093165 GGTGTGTCCAGGAGCAATCTCGG No data
1176046040_1176046052 28 Left 1176046040 20:63093093-63093115 CCCACAGAAGCTGTCATGGGTGC No data
Right 1176046052 20:63093144-63093166 GTGTGTCCAGGAGCAATCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176046040 Original CRISPR GCACCCATGACAGCTTCTGT GGG (reversed) Intergenic
No off target data available for this crispr