ID: 1176049674

View in Genome Browser
Species Human (GRCh38)
Location 20:63111349-63111371
Sequence TTTGTGAAGGCCACTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176049674_1176049677 -2 Left 1176049674 20:63111349-63111371 CCATCCTCAGTGGCCTTCACAAA No data
Right 1176049677 20:63111370-63111392 AAGATCACATGTGTCCTTGATGG No data
1176049674_1176049678 -1 Left 1176049674 20:63111349-63111371 CCATCCTCAGTGGCCTTCACAAA No data
Right 1176049678 20:63111371-63111393 AGATCACATGTGTCCTTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176049674 Original CRISPR TTTGTGAAGGCCACTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr