ID: 1176050086

View in Genome Browser
Species Human (GRCh38)
Location 20:63114456-63114478
Sequence TTGAGGCGCACGGGCTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176050086_1176050095 0 Left 1176050086 20:63114456-63114478 CCAGGACAGCCCGTGCGCCTCAA No data
Right 1176050095 20:63114479-63114501 CTTTCCCGCCGGAGGGGCAAGGG No data
1176050086_1176050090 -8 Left 1176050086 20:63114456-63114478 CCAGGACAGCCCGTGCGCCTCAA No data
Right 1176050090 20:63114471-63114493 CGCCTCAACTTTCCCGCCGGAGG No data
1176050086_1176050093 -6 Left 1176050086 20:63114456-63114478 CCAGGACAGCCCGTGCGCCTCAA No data
Right 1176050093 20:63114473-63114495 CCTCAACTTTCCCGCCGGAGGGG No data
1176050086_1176050094 -1 Left 1176050086 20:63114456-63114478 CCAGGACAGCCCGTGCGCCTCAA No data
Right 1176050094 20:63114478-63114500 ACTTTCCCGCCGGAGGGGCAAGG No data
1176050086_1176050091 -7 Left 1176050086 20:63114456-63114478 CCAGGACAGCCCGTGCGCCTCAA No data
Right 1176050091 20:63114472-63114494 GCCTCAACTTTCCCGCCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176050086 Original CRISPR TTGAGGCGCACGGGCTGTCC TGG (reversed) Intergenic
No off target data available for this crispr