ID: 1176050094

View in Genome Browser
Species Human (GRCh38)
Location 20:63114478-63114500
Sequence ACTTTCCCGCCGGAGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176050087_1176050094 -10 Left 1176050087 20:63114465-63114487 CCCGTGCGCCTCAACTTTCCCGC No data
Right 1176050094 20:63114478-63114500 ACTTTCCCGCCGGAGGGGCAAGG No data
1176050086_1176050094 -1 Left 1176050086 20:63114456-63114478 CCAGGACAGCCCGTGCGCCTCAA No data
Right 1176050094 20:63114478-63114500 ACTTTCCCGCCGGAGGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176050094 Original CRISPR ACTTTCCCGCCGGAGGGGCA AGG Intergenic
No off target data available for this crispr