ID: 1176052723

View in Genome Browser
Species Human (GRCh38)
Location 20:63129052-63129074
Sequence ACGTGGGCACCTGACTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176052714_1176052723 23 Left 1176052714 20:63129006-63129028 CCTGGGGGGATCTGAATGCCGTG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1176052723 20:63129052-63129074 ACGTGGGCACCTGACTTTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 148
1176052717_1176052723 5 Left 1176052717 20:63129024-63129046 CCGTGGGAGTCTACTTTCCTTTT 0: 1
1: 0
2: 3
3: 30
4: 333
Right 1176052723 20:63129052-63129074 ACGTGGGCACCTGACTTTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 148
1176052713_1176052723 26 Left 1176052713 20:63129003-63129025 CCACCTGGGGGGATCTGAATGCC 0: 1
1: 0
2: 2
3: 5
4: 113
Right 1176052723 20:63129052-63129074 ACGTGGGCACCTGACTTTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176052723 Original CRISPR ACGTGGGCACCTGACTTTCC TGG Intergenic
901206008 1:7496303-7496325 ACGTGAGCTCGTGACTTTCCGGG + Intronic
904741523 1:32680161-32680183 ATCTTGACACCTGACTTTCCAGG + Exonic
905169092 1:36099145-36099167 CCTTGGGCACCTGGTTTTCCAGG + Exonic
905307730 1:37031013-37031035 CCGTGGGGACCTGAATTTCCAGG - Intronic
907400586 1:54222572-54222594 ACCAGGGCATCTCACTTTCCTGG + Intronic
907642090 1:56201048-56201070 ACTTGGGCAAGTTACTTTCCAGG - Intergenic
908432139 1:64069778-64069800 GTGTGGGTACCTGGCTTTCCTGG + Intronic
917767014 1:178231214-178231236 TGGTGGTCACCTGACATTCCTGG + Intronic
919168911 1:193929186-193929208 TCATGGTCACCTGACATTCCTGG + Intergenic
920875129 1:209827798-209827820 ACGTGGGCAGCTGGGCTTCCCGG - Intergenic
922674197 1:227541095-227541117 ACATAGGCCCCTGACTTTCCTGG + Intergenic
922717569 1:227885274-227885296 ACCTGGGCCCCTGAACTTCCAGG - Intergenic
924800961 1:247329504-247329526 AGGTGGGCTCCTCATTTTCCTGG + Exonic
1062760402 10:12804-12826 ACATAGGCCCCTGACTTTCTTGG - Intergenic
1063018888 10:2105914-2105936 TGATGGTCACCTGACTTTCCTGG + Intergenic
1067166822 10:43871737-43871759 GCCAGGGCACCTGACTTCCCTGG + Intergenic
1069118564 10:64538937-64538959 CTGTGGGCACCTGACTTTAATGG + Intergenic
1069834666 10:71301081-71301103 AAGCGGGCACCTGCCTTGCCTGG - Exonic
1070782016 10:79143149-79143171 AAGTGTGCTCCTGACCTTCCAGG + Intronic
1076616710 10:131759850-131759872 CCGTGGGCATCTGCCTTCCCTGG + Intergenic
1076724807 10:132408383-132408405 GCGGGGGTACCTGCCTTTCCTGG + Intronic
1076988818 11:258283-258305 AGGTGTCCACCGGACTTTCCAGG - Intergenic
1077475328 11:2787173-2787195 ACTTGTGAACATGACTTTCCAGG + Intronic
1081204773 11:40262512-40262534 ACGTGGGCACGTGGCTTTATAGG - Intronic
1084257784 11:67954810-67954832 ACGTGAGCCCCTGAGTTACCGGG - Intergenic
1085622766 11:78049945-78049967 TGATGGTCACCTGACTTTCCTGG + Intronic
1088216953 11:107521490-107521512 ACGAGAGCAGCTGACATTCCTGG - Intronic
1088499666 11:110471153-110471175 CCCTGGGAAGCTGACTTTCCTGG + Intergenic
1089623693 11:119737835-119737857 ACATGGGCACGTGACTCCCCAGG - Intergenic
1090677592 11:129015301-129015323 ACGTTAGCTCCTGATTTTCCAGG - Intronic
1091823766 12:3494194-3494216 ACTTGGGTACCTAGCTTTCCTGG - Intronic
1094808001 12:34109346-34109368 ACGCAGGCCCCTGACTTTCCTGG - Intergenic
1095351739 12:41221822-41221844 AACTGGGCCCCTAACTTTCCTGG + Intronic
1095418869 12:42004545-42004567 AAGTGTGCACCTGACATTCCGGG - Intergenic
1103555142 12:121761741-121761763 ACCTGGGCACCTGGCTTTGTGGG + Intronic
1111344188 13:86926888-86926910 TTATGGTCACCTGACTTTCCTGG + Intergenic
1113716376 13:112511261-112511283 CCGCGGGCACCTGCCTTTCCTGG + Intronic
1113911510 13:113843501-113843523 CTGTGGGGACCTGACCTTCCTGG + Intronic
1119053885 14:71398667-71398689 AAGTAGGCACCTGAGTTCCCTGG + Intronic
1121507610 14:94488708-94488730 AGGTGAGCACCTGACTGTCTGGG - Intronic
1123147395 14:106146280-106146302 AGGTGAGCACCTCACTTACCAGG + Intergenic
1127332965 15:57956504-57956526 CCGTGGGCACCTGAGTTGACAGG + Intronic
1127634592 15:60857323-60857345 TCGTGGGAACTTGACTTGCCGGG - Intronic
1127835027 15:62783833-62783855 CTATGGGCACCTGGCTTTCCAGG + Exonic
1129199615 15:73991250-73991272 ACTTGGGCTCCTGAATCTCCAGG - Intronic
1129745344 15:78015594-78015616 ACCTGGGAACCCGACTATCCAGG + Intronic
1130975486 15:88770080-88770102 GCGTGGGCACTGGGCTTTCCCGG + Intergenic
1132927277 16:2437406-2437428 CCTTAGGCTCCTGACTTTCCAGG - Intronic
1133370223 16:5240760-5240782 ACGTGGGCCCCTGAGTGACCGGG + Intergenic
1134913664 16:18051250-18051272 AAGTGGGCTCCTGACTTTGCAGG + Intergenic
1136691345 16:32033164-32033186 AGGTGAGCACCTCACTTACCAGG - Intergenic
1136772652 16:32855373-32855395 AGGTGAGCTCCTCACTTTCCAGG - Intergenic
1136791933 16:32976729-32976751 AGGTGAGCACCTCACTTACCAGG - Intergenic
1136877884 16:33877179-33877201 AGGTGAGCACCTCACTTACCAGG + Intergenic
1136897962 16:34006146-34006168 AGGTGAGCTCCTCACTTTCCAGG + Intergenic
1142009791 16:87708033-87708055 ACGTGGGCACAGCACTTGCCAGG + Exonic
1203075077 16_KI270728v1_random:1117483-1117505 AGGTGAGCTCCTCACTTTCCAGG - Intergenic
1203094144 16_KI270728v1_random:1238193-1238215 AGGTGAGCACCTCACTTACCAGG - Intergenic
1142790678 17:2262555-2262577 ATGTGGTCAGCTGACTTTTCTGG - Intronic
1143679852 17:8468214-8468236 ACGTTGGAACCTGGCTTTACGGG - Intronic
1144211483 17:13019261-13019283 ATCTTGACACCTGACTTTCCAGG + Intergenic
1144825768 17:18104908-18104930 ACGTGTCCTCCTGACTATCCAGG - Intronic
1149154744 17:53614342-53614364 ACGTTGACACCTGACTCTCCTGG + Intergenic
1149379811 17:56082070-56082092 TGATGGGCGCCTGACTTTCCTGG + Intergenic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1150352620 17:64457767-64457789 CCATGGCCACCTGACCTTCCAGG + Intronic
1150382603 17:64732627-64732649 ATGTGGGCACCTCGCTCTCCAGG - Intergenic
1150773617 17:68061921-68061943 ATGTGGGCACCTTGCTCTCCAGG + Intergenic
1152953310 18:13158-13180 ACATAGGCCCCTGACTTTCTTGG - Intergenic
1153581346 18:6577014-6577036 ATCTGGGCAGCTGACTTTGCAGG - Intronic
1157915100 18:51656604-51656626 TGATGGTCACCTGACTTTCCTGG + Intergenic
1158845106 18:61433725-61433747 ACTTGGGCACTTGCCTCTCCTGG + Intronic
1160122702 18:76145044-76145066 ACGTGAGCACTTCACTTTCAAGG + Intergenic
1160773635 19:844560-844582 GCGAGGGCACCTGGCTTTCTGGG - Intronic
1161363844 19:3867672-3867694 GGGTGGGCACCTGGGTTTCCAGG - Intronic
1161460713 19:4395524-4395546 AGGTGAGCACCTGTATTTCCTGG - Intronic
1167890528 19:52536106-52536128 CCGTGGGGACCCCACTTTCCAGG - Intronic
1167958290 19:53085888-53085910 ACGTGTGCACCTGACTTCATGGG + Intronic
1168524047 19:57074636-57074658 CCGTGGGGACATGACTTACCTGG - Intergenic
925156746 2:1654229-1654251 ACATGGGCATCTGAGTTTTCTGG - Intronic
925587358 2:5476626-5476648 TGATGGTCACCTGACTTTCCTGG - Intergenic
926135613 2:10333527-10333549 ACGTGGGCAGCTGTGTTCCCAGG + Intronic
926302930 2:11617309-11617331 ACGGTGGCCCCTGACTTGCCCGG - Intronic
926462973 2:13156074-13156096 AGATGGGCACATGACTTTCACGG - Intergenic
927277559 2:21274498-21274520 ACCTGAGCACATGCCTTTCCTGG + Intergenic
927446989 2:23171792-23171814 ATGAGGGTACCCGACTTTCCAGG - Intergenic
933768580 2:85728594-85728616 ACGTGGGCATCTTCCTTCCCAGG - Intergenic
933768686 2:85729268-85729290 ACGTGGGCATCTTCCTTCCCAGG + Intergenic
933951024 2:87329903-87329925 ACGTGGGCACGATTCTTTCCTGG + Intergenic
936328751 2:111528677-111528699 ACGTGGGCACGATTCTTTCCTGG - Intergenic
937169549 2:119851854-119851876 ACCTGATCACCTGACATTCCTGG + Intronic
941189165 2:162355145-162355167 ACGTGGGGAACTGCCTTTCTGGG + Intronic
945598965 2:211834293-211834315 ACTTTGCCACCTGCCTTTCCAGG - Intronic
946904283 2:224401393-224401415 AGATGGGCAGCTGACTGTCCAGG + Exonic
948320400 2:237064332-237064354 ACGTGGGCACATGACACTGCCGG + Intergenic
948469788 2:238169823-238169845 ACGTGGGAAGCAGAATTTCCGGG + Intergenic
948597010 2:239086618-239086640 CCGTGGACGCCTGACTTCCCAGG + Intronic
1170409079 20:16068836-16068858 CAGTGTGCACCAGACTTTCCTGG - Intergenic
1174115490 20:48223972-48223994 ACGTGGGCACCGCAGGTTCCAGG - Intergenic
1174165126 20:48578846-48578868 ACGTGGGCACCGCAGGTTCCAGG + Intergenic
1175411403 20:58772055-58772077 ACGTGTCCACCTGACTCTTCAGG - Intergenic
1175549923 20:59810743-59810765 AAATGGGACCCTGACTTTCCTGG - Intronic
1176019032 20:62953252-62953274 ACCTGGCCTCCTGACTGTCCTGG - Intronic
1176052723 20:63129052-63129074 ACGTGGGCACCTGACTTTCCTGG + Intergenic
1179010023 21:37549328-37549350 TAGTGGTCACCTGACATTCCTGG + Intergenic
1181283470 22:21735974-21735996 ACGTGGGCTCCTGCCCGTCCCGG - Intergenic
1183590452 22:38776626-38776648 ACGTGGACACCTGGCCTTCCAGG - Intronic
1184144322 22:42599930-42599952 ACTTGGGCCCCAGTCTTTCCAGG - Intronic
950046043 3:9949204-9949226 ACCTGGGGAGCTGACTTCCCAGG + Exonic
950612505 3:14135228-14135250 ACGTGGTAACCTGGCTTCCCAGG + Exonic
957072712 3:75579298-75579320 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
957687166 3:83516449-83516471 TAATGGTCACCTGACTTTCCTGG - Intergenic
958928706 3:100186659-100186681 ACTTGGGCTCTTGTCTTTCCTGG - Intronic
961873007 3:130002126-130002148 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
962618360 3:137150983-137151005 AGGTGGGCACCTGAGCCTCCTGG - Intergenic
964249724 3:154699173-154699195 AAATGGTCACCTGACATTCCTGG - Intergenic
967587999 3:191237819-191237841 CTATGGTCACCTGACTTTCCTGG + Intronic
969796835 4:9533277-9533299 ACGTGGGCCCCTGAGTCACCGGG + Intergenic
971787219 4:31120049-31120071 TGATGGTCACCTGACTTTCCTGG + Intronic
974945237 4:68519088-68519110 TGATGGTCACCTGACTTTCCTGG - Intergenic
975282438 4:72577364-72577386 CTGTGGGCACCAGACATTCCTGG - Intergenic
976142505 4:82007220-82007242 ACGTGGGCATTTAATTTTCCTGG - Intronic
977974147 4:103244473-103244495 GTGTGGGCAGCTGACTTTTCAGG + Intergenic
979612578 4:122704749-122704771 ACATGGACACCTGACTCTCCAGG + Intergenic
983758021 4:171365942-171365964 ACTTGGGCCCCTAACTCTCCAGG - Intergenic
985822199 5:2168025-2168047 ACCTGGGCACCTCCCTTCCCAGG - Intergenic
985963149 5:3318976-3318998 GCGTGTGCACCTGGCTTTGCTGG - Intergenic
987589251 5:19902410-19902432 ACAAGGGCAGCTGGCTTTCCTGG - Intronic
988836729 5:35040197-35040219 ATGTGGCCATCTGACCTTCCTGG - Intronic
990444590 5:55882151-55882173 TGATGGTCACCTGACTTTCCTGG + Intronic
993227757 5:85189956-85189978 ATGTTCACACCTGACTTTCCAGG - Intergenic
997579070 5:135005917-135005939 GCCTGGGCACCTGCCTTGCCTGG + Intronic
999238476 5:150114048-150114070 AGGTTGGCACCTTACTTCCCTGG - Exonic
1002680654 5:180960313-180960335 ACGTGGGAACCTGACAATACAGG - Intergenic
1004326976 6:14683982-14684004 ACGTGGGCAACTGGCCTTGCTGG - Intergenic
1008879885 6:56371426-56371448 GGCTGGGCACCTGACTCTCCTGG - Intronic
1022736365 7:33079911-33079933 AGATGGTCACCTGACATTCCTGG + Intergenic
1023085487 7:36566553-36566575 AGATGGTCACCTGACATTCCTGG - Intronic
1023293630 7:38692449-38692471 TGATGGTCACCTGACTTTCCTGG + Intergenic
1024558838 7:50627085-50627107 ACATGGGCAACTGTTTTTCCAGG + Intronic
1026155997 7:67826273-67826295 TGGTGGTCACCTGACATTCCTGG - Intergenic
1028832373 7:95341950-95341972 TCATGGTCACCTGACATTCCTGG - Intergenic
1032454587 7:132063802-132063824 ACGTGGGCACCAAACTCCCCAGG - Intergenic
1035308583 7:157950825-157950847 GCGTCTGCACCTCACTTTCCTGG - Intronic
1036242731 8:7092976-7092998 ACGTGGGCCCCTGAGTCACCGGG + Intergenic
1036404694 8:8444020-8444042 CCATGGGCACCTGACTTGACAGG + Intergenic
1036829998 8:12014168-12014190 ACGTGGGCCCCTGAGTCACCGGG - Intronic
1036899086 8:12658462-12658484 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
1039415590 8:37391322-37391344 ACGTTTGCACCTCAGTTTCCTGG + Intergenic
1047027787 8:120843315-120843337 ACATGGTCACCAGAATTTCCAGG + Intergenic
1052772516 9:32702863-32702885 ACTTAGGCATCTGAGTTTCCTGG - Intergenic
1056736012 9:89209812-89209834 AGGTGGGCTCCTGAGTCTCCTGG + Intergenic
1056981771 9:91319417-91319439 ACATGGTCACCTGACATTCCTGG - Intronic
1057041948 9:91854277-91854299 ACTTGGTCACAGGACTTTCCTGG - Intronic
1060890222 9:127183377-127183399 CAGTGGGCACCAGACTTTGCGGG - Intronic
1061952787 9:133945605-133945627 ACCCGGGCCCCTGACCTTCCTGG - Intronic
1186161548 X:6782176-6782198 ACTAGGGCACCGGAATTTCCCGG - Intergenic
1187501822 X:19845164-19845186 AAGTGGGCAGGTGACTTTGCAGG + Intronic
1194413510 X:93582056-93582078 AGATGGTCACCTGACTTTCCTGG + Intergenic
1199833386 X:151565031-151565053 ACTTTGCCACCTGCCTTTCCTGG - Intronic
1199835676 X:151587754-151587776 ACTTTGCCACCTGCCTTTCCTGG + Intronic