ID: 1176052775

View in Genome Browser
Species Human (GRCh38)
Location 20:63129286-63129308
Sequence CCTCCTGAGGAGCAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 402}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176052775_1176052786 28 Left 1176052775 20:63129286-63129308 CCGTCCACCTGCTCCTCAGGAGG 0: 1
1: 0
2: 4
3: 43
4: 402
Right 1176052786 20:63129337-63129359 TTCTCTGTACATTTTAGAATTGG 0: 1
1: 0
2: 4
3: 75
4: 605

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176052775 Original CRISPR CCTCCTGAGGAGCAGGTGGA CGG (reversed) Intergenic
900245272 1:1633535-1633557 GCTCCAGAGGCGCAGGGGGATGG - Intronic
900256503 1:1700694-1700716 GCTCCAGAGGCGCAGGGGGATGG - Intronic
900410453 1:2510275-2510297 GCTCCTCAGCAGCAGGTGGCTGG - Intronic
900414026 1:2526916-2526938 CCCCCTTAGAAGCAGGTGGGCGG - Intergenic
900754426 1:4423901-4423923 GCCCATGAGGAGCTGGTGGATGG - Intergenic
902381627 1:16055530-16055552 ACTCCTGAGGGGCATGGGGATGG + Intronic
902409702 1:16205732-16205754 CCCCCTGAGGACCCCGTGGATGG - Intronic
902593847 1:17494494-17494516 CCTCCTGAGGACAAGGAGGTTGG - Intergenic
904340499 1:29831011-29831033 AGTCATGAGGAGCAGGGGGAGGG - Intergenic
905796544 1:40819328-40819350 GCTCCTGCGGGGCAGGCGGAGGG - Exonic
907799585 1:57751413-57751435 GCTCCTGAGCAGCAACTGGAGGG + Intronic
907920047 1:58903746-58903768 CCGCGGGAGGAGCGGGTGGAGGG + Intergenic
908527400 1:65001343-65001365 CCTCCTGCGGAGCTGGGGGCGGG + Intergenic
909480326 1:76123255-76123277 CCTCCCGAGTAGCTGGTAGATGG - Intronic
910844513 1:91592574-91592596 GCTCCTGGGGAGGAGGTGCATGG - Intergenic
911101570 1:94099898-94099920 CCTCTCGAGGATCAGGTGGCAGG + Intronic
912490139 1:110058201-110058223 GCTAATGAGAAGCAGGTGGAAGG + Intronic
912518499 1:110230280-110230302 CCTCCTGAAGGGCAGTTGCATGG - Intronic
914731132 1:150371483-150371505 CCTCCTGAGTAGCTGGTAGCTGG + Intronic
915065349 1:153220053-153220075 CCTCATGAGGAAGAGGTGGAGGG + Intergenic
915165436 1:153945763-153945785 CCTTCTGAGGGGCAAGTGGGTGG + Intronic
916012011 1:160714675-160714697 CCTGCTGAGCTGCAGGTGGCAGG - Intergenic
916491329 1:165304919-165304941 CCTGCTGTGGGGCAGGTGGTGGG - Intronic
916712876 1:167427499-167427521 CCTCCTGGAGTGCAGGAGGAAGG - Intergenic
917458294 1:175204771-175204793 CCTCCTGAGGAGCTGCTGGATGG - Intergenic
917484939 1:175447303-175447325 CCTTCAGAGAAGCAGGAGGAAGG - Intronic
918000017 1:180484947-180484969 CCTCCTGAGTAGCTGGTAGCTGG - Intronic
920291854 1:204929106-204929128 CCTCCTGGGGATGGGGTGGAGGG - Intronic
922795455 1:228337431-228337453 CTTCCTGAAGAGAAGGTGCAGGG + Intronic
922851800 1:228738997-228739019 CCTCCTGAGTGGCTGGTGGCTGG - Intronic
923014056 1:230112364-230112386 CCTCCAGAGGCGCCGGGGGAGGG + Intronic
923034715 1:230277632-230277654 ACTCCAGGTGAGCAGGTGGACGG + Intronic
1062888591 10:1038629-1038651 CCCCCTAAGGGGCAGGTGGAGGG + Intergenic
1063188575 10:3671742-3671764 CCTCTTGAAGAGGTGGTGGAGGG + Intergenic
1063448621 10:6136257-6136279 CCTGCTCAGCAGGAGGTGGAGGG - Intergenic
1064016867 10:11779574-11779596 TCTCCTGAGAGGCAGGGGGAAGG + Intergenic
1064450865 10:15440974-15440996 CCTATTGAGGAGTAGGTGTAGGG - Intergenic
1065081742 10:22136223-22136245 CCTCCTAAGCAGCTGGGGGAAGG + Intergenic
1066050862 10:31633443-31633465 ACTGCTGAGGAGCAGGTGGGTGG + Intergenic
1066180710 10:32958274-32958296 CCTCCTCAGGGGCGGGAGGAGGG + Intronic
1066268252 10:33797240-33797262 CCTCCTGAGTAGCTGGTAGCTGG - Intergenic
1067060485 10:43075770-43075792 CTTGCTGAGGGGCAGGTGGCCGG - Intergenic
1067065506 10:43101990-43102012 CCTCCTGAGGAGGGTGTGGCAGG + Intronic
1067479815 10:46587416-46587438 CCTCCTGGGGAGGAGGAGGGAGG + Intronic
1067570340 10:47366914-47366936 CCTCCTGTGGAGGGGATGGATGG + Exonic
1067614922 10:47754381-47754403 CCTCCTGGGGAGGAGGAGGGAGG - Intergenic
1069304546 10:66952343-66952365 CCTCCTGATGAGCTGTTGAAAGG - Intronic
1069455648 10:68551851-68551873 CCTCCAGAGTAGCTGGTGGGTGG + Intergenic
1070150280 10:73800998-73801020 ACTCCTGGGGGGCAGGGGGAGGG - Exonic
1070808870 10:79287223-79287245 CTTCCTGAGGAGCAGGCTCATGG + Intronic
1070814118 10:79312531-79312553 GGTCCTGAGAGGCAGGTGGAGGG + Intronic
1071011209 10:80942614-80942636 CCTGCTGTGGAGCATGTTGAAGG - Intergenic
1071630327 10:87214345-87214367 CCTCCTGGGGAGGAGGAGGGAGG - Intergenic
1071978209 10:90976558-90976580 GCTCCTGTTGAGTAGGTGGATGG + Intergenic
1072728884 10:97831518-97831540 TCTCATTAGGAGCAGATGGAGGG + Intergenic
1073100457 10:101003810-101003832 CCGCCTGGGGAGCTGGTGGTTGG - Exonic
1073632334 10:105161404-105161426 ACACCTGAAGGGCAGGTGGAAGG - Intronic
1074693794 10:116029844-116029866 AGCCCTGAGGAGCAGGGGGAAGG - Intergenic
1075069631 10:119312366-119312388 TCTCCCAAGGAGCAGGAGGAGGG + Intronic
1075899960 10:126033648-126033670 CCTGGTGAGGAGCAGGAGGGAGG - Intronic
1076178600 10:128387798-128387820 CCTCCTGAGGAGTTGGGGTAGGG + Intergenic
1076343417 10:129765183-129765205 GCGCCTGGGGAGCAGGTGTATGG - Intronic
1076606333 10:131692010-131692032 CCTCCCGAGGAGCAGGGACAGGG - Intergenic
1076630005 10:131846738-131846760 TCACCTGAGGAGCAGGTGTGTGG - Intergenic
1076778886 10:132713293-132713315 CATCCTGAGGAAGGGGTGGAAGG + Intronic
1077376558 11:2207943-2207965 CCCTCTGAGGAGCAGGAGCAGGG + Intergenic
1077491809 11:2864431-2864453 CACCCTGAGGGGAAGGTGGATGG - Intergenic
1077501756 11:2912580-2912602 CCACCTGGGCAGCAGGTGGGAGG + Intronic
1077517130 11:3008785-3008807 CCACCTGAGGAGCAGCTGACTGG + Intronic
1077828183 11:5833151-5833173 CCTCCTGAGTAGCTGGTAGCTGG + Intronic
1079230093 11:18642357-18642379 CCTCCTGAGTAGCTGGTAGCTGG + Intergenic
1080034834 11:27700306-27700328 CCCCCCGAGCAGGAGGTGGAGGG + Intronic
1080036720 11:27719280-27719302 CGTCCGGAGGCGCCGGTGGAGGG - Intronic
1080749117 11:35136487-35136509 CCACCTGAAGAGCAGGTGCTTGG - Intergenic
1081585825 11:44382921-44382943 CCTCCAGAGGACTTGGTGGAGGG - Intergenic
1081950793 11:47040885-47040907 CCACTTGGGGAGCAGGTGTATGG - Intronic
1083396413 11:62395675-62395697 ACTTCAGAGGAGCAGGTGGGGGG - Intergenic
1083492140 11:63020990-63021012 GCTCCTTAGCAGCAGGCGGAGGG + Intergenic
1083764708 11:64836283-64836305 CCTCCTCAGGAGCTGGCCGAGGG - Exonic
1083770481 11:64864248-64864270 CTTCCAGAGGCTCAGGTGGATGG + Intronic
1084085457 11:66853009-66853031 CGTCTTGAGGACCACGTGGATGG + Intronic
1084090504 11:66876515-66876537 CCTCTTGAGCAGCAGGTGCTGGG - Intronic
1084322955 11:68383784-68383806 TTTCCTGAGGAGGAGGTGGCGGG + Intronic
1084444050 11:69193188-69193210 CTTCCTGAGGAGCTGGTCGGGGG + Intergenic
1085252386 11:75152393-75152415 CCAGCTGAGGAGCAGCTGCAGGG + Intronic
1085524366 11:77155736-77155758 CCTCCTTAGGAGCTGGGGCAGGG - Intronic
1087666882 11:101059719-101059741 CCTCCTGATGAGCTGGTAGCTGG - Intronic
1088624741 11:111721811-111721833 CTTCCTGAGGAGCAAGGGGGTGG - Exonic
1088940751 11:114453454-114453476 CCTCCTGAGGAGTGGTTGGAAGG - Intergenic
1089086085 11:115818022-115818044 CCTCCTCTGGAGCAGGGGAAGGG + Intergenic
1089218691 11:116852498-116852520 CTTCCTGAGGAGCAGGAGCTCGG + Intronic
1089479189 11:118791350-118791372 CTTCCTGAGGAGAAAATGGAGGG + Intergenic
1089775844 11:120835191-120835213 CTCCCTGAGGAGCAGGTCGGGGG - Intronic
1090399696 11:126441147-126441169 CCTCCTGAGACACAGGTGGGAGG - Intronic
1090571745 11:128054717-128054739 CCACATAAGGTGCAGGTGGATGG + Intergenic
1091169448 11:133507266-133507288 CCCTCTGTGGAGCAGGAGGATGG + Intronic
1091272675 11:134328845-134328867 TCTCCTGAGGGGAGGGTGGATGG + Intergenic
1091629179 12:2146512-2146534 CCTCCTGTGGCGCCAGTGGAGGG - Intronic
1091772419 12:3161534-3161556 CCACCTGGGGAGCAGGAGGTAGG + Intronic
1091777304 12:3192789-3192811 CTCCCTGAGGAGGAGGAGGAGGG + Intronic
1091823232 12:3491645-3491667 CCTCCTCAGGAGCAGGCAGCGGG - Exonic
1092829454 12:12429697-12429719 CCTCTTGAGAAAAAGGTGGAGGG - Intronic
1095666987 12:44814140-44814162 CCTCAGGAGGAGCAGATGGAGGG + Intronic
1095960709 12:47832808-47832830 CCTCTTGAGGAACAGTGGGAAGG + Intronic
1096240295 12:49956203-49956225 CCTCCTCAGGAGAAGGGGAAGGG + Exonic
1096286953 12:50308596-50308618 CCTCCTGAGTAGCAGGTAGCTGG - Intergenic
1096500233 12:52060311-52060333 CCTTCTGAGAAACATGTGGATGG + Intergenic
1096676773 12:53230512-53230534 CCTCCTGGGGAGCAGGCTGGGGG - Intronic
1099012658 12:77310142-77310164 CCCACTGAGGGGAAGGTGGAGGG - Intergenic
1100302629 12:93322020-93322042 CAACCAGAAGAGCAGGTGGAAGG + Intergenic
1100449898 12:94695967-94695989 GATCTTGAGGGGCAGGTGGAAGG - Intergenic
1101496150 12:105256201-105256223 AATCCTGAGCAGGAGGTGGAAGG - Intronic
1102703995 12:114865473-114865495 CATCCTGAACAGCAGGTGGTAGG + Intergenic
1103734403 12:123050087-123050109 CCTCCTCAAGAGCATGTGCAGGG + Intronic
1104326928 12:127808012-127808034 CCTTGCGAGGAGCAGATGGAAGG - Intergenic
1104665306 12:130643396-130643418 CCTCCTGAGGACCAGGACCATGG + Intronic
1104902283 12:132195992-132196014 ACTCCAGAGGGGCAGGTGGGAGG - Intergenic
1104966548 12:132511075-132511097 CCTCCTGACTACCAGGGGGAGGG - Intronic
1105804628 13:23945967-23945989 CCTGCTCAGGAGCCGGTGGTTGG - Intergenic
1105804834 13:23946779-23946801 CCACCTGGGGAGCATGTGGGTGG + Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1107538617 13:41362737-41362759 CCTCCTGTGGTCCATGTGGAAGG - Intronic
1108198048 13:48014753-48014775 CATTCTGAGGCCCAGGTGGATGG - Intergenic
1108546545 13:51501024-51501046 CCTCCTAAGTTGCAGGTGGAGGG + Intergenic
1108580265 13:51822277-51822299 CTTCCTGAGGATCAGGTGACTGG - Intergenic
1108699339 13:52930502-52930524 CCTTCTGGGGTGGAGGTGGAGGG + Intergenic
1112054837 13:95680847-95680869 CGTTCTGAAGAGCAGGTGAATGG - Intronic
1114050250 14:18915588-18915610 GCTGGTGAGAAGCAGGTGGAAGG - Intergenic
1114112308 14:19486344-19486366 GCTGGTGAGAAGCAGGTGGAAGG + Intergenic
1115649975 14:35396216-35396238 CCTCCTGAGTAGCTGGTGTCAGG + Intergenic
1116369523 14:44111312-44111334 CCTCAAGAGGATAAGGTGGAAGG - Intergenic
1118208597 14:63746249-63746271 ACTCCTGAGCAGCAGGGGGTTGG + Intergenic
1119644615 14:76339452-76339474 CCCCAAGAGGTGCAGGTGGAAGG - Intronic
1119823475 14:77638596-77638618 CCTCCTGAAGATCAGGAGGCAGG + Intergenic
1121433413 14:93903204-93903226 TTTGCTGTGGAGCAGGTGGAGGG + Intergenic
1121492905 14:94372532-94372554 CCTCCTGAGGGGGAGGGGGAGGG + Intergenic
1122143085 14:99674007-99674029 CAGCCTGAGGAGCAGGAGGTGGG + Intronic
1122878048 14:104677850-104677872 CCTCCTTGGGAGGAGGAGGAAGG - Intergenic
1122960710 14:105092613-105092635 GCTCCTGAGAGGCAGGAGGATGG + Intergenic
1123491742 15:20786507-20786529 CCTCCTGAGTAGCTGGTAGCTGG + Intergenic
1123548244 15:21355601-21355623 CCTCCTGAGTAGCTGGTAGCTGG + Intergenic
1124007464 15:25806203-25806225 CGTGCTGAGGAGGAAGTGGAGGG - Intronic
1124045793 15:26148754-26148776 GCTCCTGGGGACCAGGTGGGTGG + Intergenic
1127282361 15:57503227-57503249 CCTCATCAGGAGTAGGAGGAAGG - Intronic
1128784845 15:70387267-70387289 CGTGCTGAGGGGCAGGCGGAGGG + Intergenic
1128792543 15:70443704-70443726 CCTCCGGAGGTGCTGGGGGAGGG - Intergenic
1129244506 15:74271347-74271369 CCTCCCCAGGAGCCAGTGGAGGG + Intronic
1129253365 15:74320549-74320571 CCTGCTGGGGAGCAGGTGGAAGG + Intronic
1129532266 15:76277865-76277887 CCTCCACAGGAGCTGGTGGTGGG - Intronic
1129854590 15:78814178-78814200 CCTGCTCAGGAGAATGTGGAGGG + Intronic
1131203993 15:90426095-90426117 TCTCCTTTGGTGCAGGTGGATGG + Exonic
1202956576 15_KI270727v1_random:82831-82853 CCTCCTGAGTAGCTGGTAGCTGG + Intergenic
1132538878 16:498280-498302 CCTCAGGAGGAGGAGGTGGGAGG - Intronic
1132585626 16:704889-704911 CCTCCTGGGGATTAGGTGGGTGG - Intronic
1132831604 16:1930813-1930835 CCTCCCGAGTAGCTGGTGTAGGG + Intergenic
1132854021 16:2036860-2036882 CCCACCGAGGAGCACGTGGAAGG + Exonic
1132860011 16:2065786-2065808 CCTCCACAAGAGCAGGAGGAAGG - Intronic
1133304638 16:4801582-4801604 CCTCCTGTGGAACAGAGGGAAGG + Exonic
1134618238 16:15668371-15668393 ACTCCCGAGGTTCAGGTGGAAGG - Intronic
1135355225 16:21763483-21763505 CCACCAGAGGAGGAGGTGAAGGG - Intergenic
1135453710 16:22579625-22579647 CCGCCAGAGGAGGAGGTGAAGGG - Intergenic
1135470012 16:22721876-22721898 CCTCCAGAGCAGCTGGTGAAAGG - Intergenic
1135925769 16:26692721-26692743 CCTCCTGAAGAGCTAGAGGATGG - Intergenic
1137552524 16:49449356-49449378 CCTCCTGAGTAGCTGGGGCAAGG - Intergenic
1138021443 16:53485745-53485767 ACTCCGGAGGATAAGGTGGAAGG + Intronic
1138243018 16:55444482-55444504 CCTCCTGAGCAGGAGGTGCTGGG + Intronic
1138528464 16:57622012-57622034 CCTCGTGAGGCTCAGGTGGGAGG + Intronic
1138750420 16:59413142-59413164 CCTCCTGAGTATCAGGTAGCTGG + Intergenic
1139516519 16:67455430-67455452 CCCCCAGAGATGCAGGTGGAAGG - Intronic
1140041382 16:71410488-71410510 CCTCCTGAGGAGCACAGGAAGGG - Intergenic
1140262198 16:73390163-73390185 CCACCTGAGGAACAGGTAGAGGG - Intergenic
1141143684 16:81514312-81514334 CCTCCAGAGGATCAGGGTGAGGG + Intronic
1141200178 16:81891678-81891700 CCTGTTGTGAAGCAGGTGGAGGG + Intronic
1141368072 16:83462632-83462654 CCTCCTGAGTAGCAAGTTGCAGG - Intronic
1141521376 16:84582107-84582129 CCTCCTGAGTAGCTGGTAGCTGG + Intronic
1141575345 16:84959832-84959854 CCTCCTGATAAGAAAGTGGAAGG + Intergenic
1141652140 16:85398368-85398390 CCTCCTGAGCAGGAGGTGGAGGG + Intergenic
1142143416 16:88482730-88482752 CCTCCTGCTGAGCAGCTGTAGGG - Intronic
1142554679 17:765832-765854 CCTCCTGAGTAGCTGGTAGCTGG - Intronic
1142807786 17:2380526-2380548 CATCCTGAGAAGCATGTGGAAGG - Exonic
1143328401 17:6116806-6116828 CCTGCAGAGGGGCAGGTGGTAGG + Intronic
1144631018 17:16872536-16872558 CCTGCTGAGGAGCAAGGGGTTGG - Intergenic
1144863485 17:18320326-18320348 CCTCCTGAGGAGGAGCTTTATGG + Intronic
1145886346 17:28384833-28384855 CCCCAGGAGCAGCAGGTGGATGG + Exonic
1146751873 17:35389327-35389349 CCTAGTGATGAGCAGGTGGGTGG + Intergenic
1147393093 17:40122151-40122173 CCTCCTCAGGAGGGGGTGGAGGG - Intergenic
1147452917 17:40517195-40517217 CCTCCTGGGGGGCAGGTGCTAGG + Intergenic
1147844048 17:43392551-43392573 CTTCCTGAGGAGCAGAATGAGGG - Intergenic
1148876911 17:50693601-50693623 CCTCCAGAGGAGCAGCTGCAGGG - Exonic
1150423182 17:65056634-65056656 CCGCCGGAGGAGGAGGTGGAGGG - Exonic
1150473110 17:65454178-65454200 CCTCATGTGGGGAAGGTGGAGGG - Intergenic
1150614828 17:66762367-66762389 CCACCTGACAAGCAGGTGGTGGG - Intronic
1150656232 17:67041643-67041665 CTGGCTGCGGAGCAGGTGGAAGG - Intergenic
1152096947 17:78278143-78278165 CCTCCAGGGGAGCAGGTGGGAGG - Intergenic
1152413305 17:80142394-80142416 CCTGCTGTGGAGCAGGTGAAAGG - Intronic
1152614512 17:81331602-81331624 CCACCTGTGGGGCAGGGGGAGGG + Intergenic
1152656918 17:81524089-81524111 CTTTCTGAGGTGCTGGTGGACGG - Intergenic
1155324810 18:24655132-24655154 TCACCTGAGGAGCTGGTGGGTGG - Intergenic
1155844325 18:30686541-30686563 CCAACTGAGGAGCAGGGGTAAGG - Intergenic
1157577372 18:48752604-48752626 CCACCTGAGGGGCAGTTGTAAGG - Intronic
1157831368 18:50859779-50859801 CCTGCAGAGGAGGAGATGGAAGG - Intergenic
1158250797 18:55485330-55485352 CCTACTGGGGTGCTGGTGGAGGG - Intronic
1160231805 18:77054444-77054466 GCCCCTGGGGAACAGGTGGAGGG + Intronic
1160386151 18:78498117-78498139 GCTCCTGAGGACCAGGGGCATGG + Intergenic
1160993946 19:1873293-1873315 TCCCCTGGGGAGCAGCTGGAGGG + Intergenic
1161124890 19:2550337-2550359 CCTCCTGAGTAGCTGGTAGCTGG + Intronic
1161341527 19:3745787-3745809 CCTCCTGAGGAGTGGGTGGCTGG - Intronic
1161373963 19:3929370-3929392 CTTCCTGGGGACCAGGAGGAAGG + Intergenic
1161626143 19:5327970-5327992 TCTCCTGAGGAGAAGGTGAGAGG - Intronic
1162102045 19:8344744-8344766 CCTCCTGAGGCTGAGGTGGGAGG + Intronic
1162548015 19:11342733-11342755 CCCCATGAGAAGCAGGGGGAGGG - Intronic
1163146143 19:15380222-15380244 CCCCCAGAGGAGGAGGAGGAGGG - Exonic
1163290668 19:16377217-16377239 CCTCCCAAGGAGGAGGTGAAAGG + Exonic
1163640838 19:18461144-18461166 CACCCGGAGGCGCAGGTGGAGGG + Intronic
1163676079 19:18655967-18655989 ACCCCTGAGGAGCAGGTGAGGGG + Intronic
1163852952 19:19676521-19676543 CCTTCTGAATAGCAGGTGGATGG - Intronic
1165052531 19:33151123-33151145 CCTCCAGCCCAGCAGGTGGAAGG + Intronic
1166360724 19:42251933-42251955 CACCCTGAGGGGCTGGTGGAAGG - Intronic
1166416182 19:42596173-42596195 CCTCCTGGGGTGCAGAGGGAAGG + Intronic
1166568363 19:43778814-43778836 CCCCCTGGGGAGCAGGTGTCTGG + Intronic
1166813367 19:45527201-45527223 CCTCCTAAGGGGCATGGGGAGGG - Intergenic
1166859658 19:45802318-45802340 CCTCCTGTGGGGGAGGTGAAGGG + Intronic
1167044440 19:47041377-47041399 CCTCCTCAGGCTCAGGTGGAGGG + Intronic
1167566773 19:50261736-50261758 AGGGCTGAGGAGCAGGTGGATGG + Intronic
1167833715 19:52048841-52048863 CCTCCTGAGGAAAAGCCGGAAGG - Intronic
925161535 2:1687412-1687434 CGTCCTGAGGGGTGGGTGGAGGG + Intronic
925667982 2:6282011-6282033 GCTCCTGGAGAGCAGGTGGTGGG + Intergenic
925756675 2:7139395-7139417 CCACCTGTGGAGGGGGTGGAGGG + Intergenic
926125245 2:10267875-10267897 TTCCCTGAGGAGCAGGTGGAGGG - Intergenic
926126975 2:10277900-10277922 GCATCTGAGGAACAGGTGGAGGG + Intergenic
926236749 2:11051466-11051488 CCTCATGAAGAACACGTGGACGG + Intergenic
926625234 2:15085308-15085330 CCTCCTGAGGCGCAGGAACACGG - Intergenic
928858162 2:35825050-35825072 CCACCTCAGGAGGAGATGGAAGG + Intergenic
929277931 2:40045479-40045501 CCTCCTGAGTAGCTGGTAGCTGG + Intergenic
935118525 2:100159266-100159288 CCTCCTGAGTAGCTGGTGTTGGG - Intergenic
935738213 2:106123575-106123597 GCTCCTGTAGGGCAGGTGGAGGG + Intronic
938297265 2:130185955-130185977 GAACCTGAGGAGGAGGTGGAGGG + Intronic
938459511 2:131488720-131488742 GAACCTGAGGAGGAGGTGGAGGG - Intronic
938463934 2:131514795-131514817 CAGGATGAGGAGCAGGTGGAAGG + Intergenic
938482146 2:131671659-131671681 CCTCCTGAGTAGCTGGTAGCTGG - Intergenic
942281279 2:174366099-174366121 CCTCCTGAGGAGCCCGTCAAAGG - Intronic
943701257 2:190990237-190990259 CGTTCAGTGGAGCAGGTGGATGG + Intronic
944081778 2:195796305-195796327 AATCCTGAGGAGCAGGCTGAAGG - Intronic
945926553 2:215811524-215811546 TCTCCTGAGGATGAGGTGGGAGG - Intergenic
946043000 2:216798453-216798475 CCTCCTGAGGCTCAGTAGGATGG + Intergenic
946312192 2:218888462-218888484 CCTCCTGAACATCTGGTGGAAGG + Intronic
946398204 2:219453974-219453996 CCTGGTGGGGAGCAGGTAGAGGG + Intronic
947550389 2:231041432-231041454 CATCCTGAGGGCCAGGTGCATGG + Intronic
947726025 2:232401325-232401347 ACTCCTGAGGCAGAGGTGGAAGG - Intergenic
948836183 2:240627052-240627074 CCTCCTGGGCAGGAAGTGGAAGG + Intronic
1169390648 20:5187767-5187789 CCTCCTGAGTAGCTGGTAGCTGG - Intronic
1169908083 20:10623786-10623808 CAGGCTGAGGAGCAGGGGGATGG - Exonic
1170029654 20:11931615-11931637 CCCTCTGAGAAGCAGATGGAAGG - Intergenic
1170140864 20:13123922-13123944 GCTCCTGAGGAGCAGCAGCAGGG - Intronic
1170155571 20:13266085-13266107 CCCCATGAGGAGTAAGTGGAAGG - Intronic
1171059321 20:21940780-21940802 CCTCATGGGGAGCTGGGGGAAGG + Intergenic
1171370737 20:24660752-24660774 CCAGCTGAGGGGCAAGTGGATGG - Intronic
1171393481 20:24816142-24816164 CCTCCTGAAAAGCAGGAGCATGG + Intergenic
1172178459 20:32986567-32986589 CCTCCTGAGGAGCTGGGGCCAGG + Intronic
1172199325 20:33114100-33114122 CCTCCTGAGGAAAGGGTGGGAGG - Intergenic
1172390808 20:34563765-34563787 CCTCCTGAGGAGCAGGGAAAGGG + Intronic
1172519850 20:35559487-35559509 CCGCCTGAGGGGCTGGTGGCCGG - Intergenic
1172626491 20:36350381-36350403 CCTCCTCAGGGCCAGGTGGATGG - Intronic
1172910462 20:38405387-38405409 AATCCAGAGGAGCAGCTGGAGGG - Intergenic
1173334560 20:42102049-42102071 CTTCCTGAGGTGGAGGTGGCTGG - Intronic
1173751545 20:45480493-45480515 CCTCCTGAGTAGCGGGTGGGTGG - Intronic
1174392532 20:50226754-50226776 CCTCCTAGGGAGCAGGTGGGTGG + Intergenic
1175720325 20:61281741-61281763 CCTCCAGGGGAGGAGGTGGCGGG - Intronic
1176046946 20:63097643-63097665 CCTCCTAAGCAGGACGTGGAGGG - Intergenic
1176052775 20:63129286-63129308 CCTCCTGAGGAGCAGGTGGACGG - Intergenic
1176053423 20:63132760-63132782 TCTGCTGAGGAAAAGGTGGACGG + Intergenic
1176236792 20:64057157-64057179 CCACATGACGTGCAGGTGGAGGG - Intronic
1178628973 21:34243050-34243072 CATCCTCTGGGGCAGGTGGAAGG + Intergenic
1179712439 21:43271148-43271170 CCTGCGGAGGAGGATGTGGAGGG + Intergenic
1179904715 21:44416479-44416501 CCTCCAGGGGTGCATGTGGAAGG - Intronic
1180158665 21:45989557-45989579 CCCCCGGAGGAGCAGGGGCAGGG - Intronic
1180468729 22:15637962-15637984 GCTGGTGAGAAGCAGGTGGAAGG - Intergenic
1180743119 22:18067540-18067562 CCTCATAAGGATCAGGAGGAGGG - Intergenic
1181107515 22:20583825-20583847 GCTGGTGAGAAGCAGGTGGAAGG + Intronic
1181136899 22:20773701-20773723 AGTCCTGGAGAGCAGGTGGAGGG + Intronic
1181809177 22:25393031-25393053 TCTCCTGAGGTGCAGGGGGCAGG + Intronic
1182097072 22:27633212-27633234 TCTGGTGCGGAGCAGGTGGAGGG - Intergenic
1182132858 22:27870829-27870851 CCTCCACAGCAGCAAGTGGATGG + Intronic
1182325967 22:29513233-29513255 CCTCCTGAGTAGCTGGTAGCTGG - Intronic
1183292340 22:37010475-37010497 CATGCTCAGGAGCAGGTGAAAGG - Intergenic
1183327049 22:37199922-37199944 CCTTCTGAAGAGCAGGCGCAGGG + Intergenic
1184066403 22:42124167-42124189 CCTGCTGAGCAGGAGGTGGCAGG + Intergenic
1184068871 22:42136319-42136341 CCTGCTGAGCAGGAGGTGGCAGG + Intergenic
1184362261 22:44025456-44025478 AATCCTGGGGAGCAGGTGCATGG - Intronic
1184426792 22:44413731-44413753 CCTCAGGAGGAGGAGGAGGAGGG + Intergenic
1184430945 22:44441324-44441346 CCTCCTCAAGGGCAGGAGGAAGG + Intergenic
1184892984 22:47390741-47390763 CCTGCTGAGCAGCAGGTGGAGGG - Intergenic
1185116714 22:48942089-48942111 CTCCCAGAGGAGCAGGTGGGAGG + Intergenic
1185384273 22:50524665-50524687 CTTGCTGAGGTGCAGGTGCAGGG - Intronic
949201043 3:1379687-1379709 CTTCCTGAGGAGGAGGTGGGGGG + Intronic
950433677 3:12966443-12966465 CCTTCTGAGGAGCAGGGGGGTGG - Intronic
950607642 3:14096874-14096896 CAGCCTGAGCAGCAGGTGGATGG + Intergenic
951081993 3:18463511-18463533 CCATCTGAGGACCAGCTGGAAGG - Intergenic
952774001 3:37027272-37027294 ACTCCGGAGGCTCAGGTGGAAGG + Intronic
954246961 3:49339781-49339803 TCTCCTGAGGGGCAGGTGTCAGG + Intronic
954285744 3:49617706-49617728 CCTCCTGAGGAGGCCTTGGACGG + Intronic
954455019 3:50593069-50593091 CCTCCTCAAGACCAAGTGGAAGG - Intergenic
954767642 3:52934376-52934398 ACTGCTGAAAAGCAGGTGGAAGG + Intronic
954993331 3:54859798-54859820 CCTCTTGAGGAGCAAGTCAAGGG + Intronic
956462330 3:69484983-69485005 CCTCCTGGGCAGAAGGTGGGGGG - Intronic
957550529 3:81697786-81697808 CCTGCTTTGGAGCAGGTGGAAGG + Intronic
964201720 3:154124711-154124733 CTTCCTGAGGAACATGGGGATGG - Intronic
964351404 3:155806595-155806617 GTTCCTTGGGAGCAGGTGGAAGG - Intergenic
965447548 3:168794241-168794263 GCTCCTGAGAAGGATGTGGATGG + Intergenic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
966807212 3:183817130-183817152 CCTCTTGAGAAGCCTGTGGAAGG - Exonic
968078175 3:195828304-195828326 CCAACTGAGGAGGAGGAGGAGGG + Intergenic
968657154 4:1783580-1783602 CCCACTGAAGAGCAGGGGGACGG - Intergenic
968872153 4:3247616-3247638 TCTCCTGAGGCCCAGATGGAAGG + Exonic
969631383 4:8340698-8340720 CCTCCTGAGGTGTAGATGGGAGG - Intergenic
969932135 4:10641153-10641175 CCTCCTGAGGGACAGTTGGAGGG + Intronic
970154806 4:13131010-13131032 ACTCCTGGGGAGGAGGTGGCGGG + Intergenic
976325000 4:83761254-83761276 CCTCCAGAGAATAAGGTGGAAGG - Intergenic
977085746 4:92596417-92596439 CCTCCTGATGTGCAGGTGTTTGG - Intronic
979107362 4:116705362-116705384 GTTTCTGAGGAGCAGGGGGAGGG - Intergenic
982324822 4:154119496-154119518 CCCTCTGAGGAGCAGGAGAAGGG - Intergenic
984218932 4:176949259-176949281 CCTCCTGTAGAGCATCTGGAAGG + Intergenic
984785885 4:183566930-183566952 AGTCCTGAGGAGCTGGTGGTGGG - Intergenic
985576114 5:674264-674286 CCTGCTGAGGAGCAGCTGCCAGG + Intronic
985641033 5:1063645-1063667 CCTCGTGAGGTGGGGGTGGAGGG - Intronic
985641050 5:1063694-1063716 CCTCGTGAGGTGGGGGTGGAGGG - Intronic
985641067 5:1063743-1063765 CCTCGTGAGGTGGGGGTGGAGGG - Intronic
985803382 5:2020976-2020998 GCTCCTGAGGTGCAGGTGCCCGG - Intergenic
986141558 5:5035651-5035673 CCTCCAGTGGTGCAGGTGGAGGG - Intergenic
986249532 5:6043973-6043995 CATCCTGAGGGGCAGCTGGTGGG - Intergenic
986251241 5:6060319-6060341 GAGCCTGGGGAGCAGGTGGAAGG + Intergenic
986591216 5:9372916-9372938 CCGCAGGAGGAGCAGGTGGCAGG + Intronic
989121601 5:38009980-38010002 CCTCCTGAGGAGCAGCACGCTGG - Intergenic
990632789 5:57689071-57689093 GCTCTGCAGGAGCAGGTGGATGG + Intergenic
991409001 5:66328538-66328560 ACTCCTGAGGAGAAGGTGAAGGG + Intergenic
992595706 5:78345345-78345367 CATCAAGAGGAGAAGGTGGAGGG - Intergenic
992623144 5:78613092-78613114 CCTCCTGAGGGGCAGGGGCAAGG + Intronic
992943368 5:81785271-81785293 CATGCTGATGAGCAGGCGGAAGG + Intergenic
995453289 5:112326232-112326254 CATCCCCAGGATCAGGTGGAGGG + Intronic
997739164 5:136238639-136238661 CAGCCTGAGAAGCAGATGGAGGG + Intronic
997999102 5:138610112-138610134 GCTCCTGAGAAGCAGTGGGAAGG + Intergenic
998072320 5:139207734-139207756 GTTCCTGAGGAGCAGGTGTTAGG - Intronic
999276040 5:150330822-150330844 CCTCCTGACGATCAGATTGAAGG - Intronic
1001993369 5:176134863-176134885 CCTGCTGAGGGGGAGGTGGTGGG + Intergenic
1002305811 5:178282111-178282133 CCTGCAGAGGAGCAGCTGAACGG - Intronic
1002595232 5:180317868-180317890 CCTCCAGAGCATCAGGTGCAGGG - Intronic
1002722693 5:181273243-181273265 CCGGCTGAGGAGCCGGTGGTTGG - Intergenic
1003096817 6:3148652-3148674 CCACCTGAGCAGCAGCTGGGAGG - Intronic
1003538694 6:6999476-6999498 CCTTGTGAGGCTCAGGTGGAAGG + Intergenic
1003749497 6:9040576-9040598 CCTCCTGAGAAGCTGGTGAAAGG + Intergenic
1003887586 6:10535211-10535233 CCTCCAGAGGACCTGCTGGATGG - Intronic
1006255983 6:32832627-32832649 CCTCCTTACGAGCAGGTACAAGG + Exonic
1006403032 6:33828880-33828902 ACTCCTGTGGGGCAGGTGGCAGG - Intergenic
1006520553 6:34568699-34568721 CCTCCTGTGGAGCTGGTGATAGG - Intergenic
1006694744 6:35921209-35921231 CCTCCTCGGGAGCAGGTGGTAGG - Exonic
1007239331 6:40413832-40413854 CCTCCTTATGTGCAGGTGGGTGG + Intronic
1009648287 6:66438308-66438330 CCTGGTGAGGAGATGGTGGAGGG + Intergenic
1011503097 6:88012388-88012410 CCCCCTCGGGAGCAGGTGGTAGG + Intergenic
1012029947 6:94046296-94046318 CTTTCTGAAGAGAAGGTGGAAGG - Intergenic
1012492633 6:99799427-99799449 CTTTCTGAGGTCCAGGTGGAAGG + Intergenic
1015499869 6:133920901-133920923 CCACCTGAGGAGACGATGGATGG + Intergenic
1017871747 6:158492700-158492722 GCTCCTGAGGAGTGGGAGGATGG - Intronic
1018171959 6:161150712-161150734 CCTCCTGAGGAGTAGCTGCCTGG + Intronic
1018305944 6:162455285-162455307 ACTACAGAGGAGTAGGTGGATGG - Intronic
1018471674 6:164102715-164102737 CCACCTGGGGAGGAGGGGGAGGG - Intergenic
1022514046 7:30964239-30964261 CCTCCCTACGAGCAGGTGGCAGG + Intronic
1023346781 7:39278856-39278878 CAGCCTGAGGAACATGTGGATGG - Intronic
1023864341 7:44231808-44231830 CCTCCTGGGGACCTGGGGGATGG - Intronic
1024211390 7:47208786-47208808 TCTCCTGAGGACCATGTGGGTGG - Intergenic
1024933543 7:54689480-54689502 CCACCTGTGGAGTAGGAGGAGGG - Intergenic
1025007665 7:55366576-55366598 ACTTCTGAGGAGCAGGTAGCCGG - Intronic
1026724783 7:72862829-72862851 CCTACCTAGGAGCAGGGGGAGGG - Intergenic
1026940824 7:74287038-74287060 CCTCCTGAGGCACATGTGGGAGG + Intergenic
1027526746 7:79278792-79278814 CCACCTAAGTAGCAGGTGGTAGG - Intronic
1028839873 7:95417339-95417361 CTTTCTGAGGAGCAGGCAGATGG - Intronic
1029192003 7:98778536-98778558 CCTCCTGAGGCGTGGGTTGATGG - Intergenic
1029269904 7:99371002-99371024 CCTCCTGAGTAGCAAGTAGCTGG + Intronic
1029486766 7:100847709-100847731 CCACAGGAGGAGCAGGTGGTGGG + Intronic
1029700707 7:102245149-102245171 ACTCCTGAGGCTCAGATGGAAGG - Intronic
1031385786 7:121149210-121149232 TTTCCTGAGCAGCAGGTGCACGG + Intronic
1031570444 7:123352704-123352726 CCAGCTGAGAGGCAGGTGGAAGG - Intergenic
1033628997 7:143139053-143139075 CCTGGTGAGGAGAAGGTGGGAGG - Exonic
1035219751 7:157399306-157399328 CCTCCTGATGAGTAGGTGCCAGG + Intronic
1035336666 7:158133753-158133775 CCTCCTGAGCACCCGCTGGAAGG + Exonic
1036559224 8:9887516-9887538 CCACCTCAGGAGAAGGTGTAAGG - Intergenic
1037731121 8:21524704-21524726 CCCACTGAGGAGCAGGGGAATGG + Intergenic
1037787442 8:21911293-21911315 GCTTTTGAGGAGCTGGTGGAGGG - Intronic
1038892754 8:31745201-31745223 CCTGCTGAGTAGCTGGTGGAAGG + Intronic
1039406557 8:37318327-37318349 CCCCCTGAGGAGCAGGAGCCAGG + Intergenic
1039552990 8:38456683-38456705 CCTCCTGAGTAGCAAGTAGCTGG + Intronic
1039799792 8:40944358-40944380 CCTTCTGAGGAGCAGAGAGAAGG - Intergenic
1041073903 8:54151668-54151690 CCTCCTGAGTAGCTGGTAGCTGG + Intergenic
1041251119 8:55935657-55935679 CCTCCTGAGTAGCAAGTAGTGGG - Intronic
1042284428 8:67092557-67092579 CCTCCTGAGTAGCTGGAGGCAGG + Intronic
1044486188 8:92757162-92757184 CCTCCTGGGGAAGAGGTGGTAGG + Intergenic
1045113270 8:98953478-98953500 CTTCCTGAGGAGTAGGGGTAGGG + Intergenic
1047251877 8:123186931-123186953 TCTCCTAAGGAGCAGGTGGTTGG - Intronic
1048297200 8:133223172-133223194 CCTCCTGGGGAGGTGGTGGTGGG - Intronic
1048794600 8:138138189-138138211 TCTCCTGTGGAGGAGGAGGAGGG - Intronic
1049046667 8:140157406-140157428 CTTTCTGTGGACCAGGTGGAGGG + Intronic
1049163216 8:141111008-141111030 CCACCTGAGAAGCAGGTTCAGGG - Intergenic
1049298115 8:141854685-141854707 CCCCCAGAGGAGCAGGTGTTGGG - Intergenic
1049384147 8:142332611-142332633 CCTCATGAGGACATGGTGGATGG + Intronic
1049451950 8:142666704-142666726 CCACCTGAGCAGCACGTGCAGGG - Intronic
1049496776 8:142939275-142939297 GCTCCAGAGGAGCGGGTGGCGGG + Intergenic
1049611803 8:143559323-143559345 CCTCCTCAGGAGCATGGGGTCGG + Exonic
1049785893 8:144450595-144450617 GCTCTTGAGGAGGAGCTGGAAGG + Exonic
1050873386 9:10604490-10604512 CCTCCTGAGGGGCAGGAAAATGG + Intronic
1051031454 9:12684989-12685011 CCTCCGGAGGAGGACTTGGAAGG - Intergenic
1051414585 9:16825608-16825630 CTTCCTGGGGAGGAGGAGGAGGG + Intronic
1051686536 9:19663933-19663955 CCTTCTAATAAGCAGGTGGATGG + Intronic
1052588669 9:30462580-30462602 CCTCCTGAGTAGCAGGACTACGG - Intergenic
1052996021 9:34552018-34552040 CCTGCAGAGGAGCAGGAGGCCGG - Exonic
1054093885 9:60880408-60880430 CCACCTGAGGAGCCGCTTGATGG - Intergenic
1054115359 9:61156331-61156353 CCACCTGAGGAGCCGCTTGATGG - Intergenic
1054592397 9:67026211-67026233 CCACCTGAGGAGCCGCTTGATGG + Intergenic
1055943751 9:81674382-81674404 GCTCCTGAGGAGCAACCGGAAGG + Intronic
1056591206 9:87967423-87967445 GGTCCTGAGGAGCAGGCAGACGG + Exonic
1056646951 9:88421422-88421444 CCTCCTGAGTAGCTGGTAGCTGG + Intronic
1057183226 9:93040871-93040893 CCTCCTGTGGCCCAGCTGGAAGG - Intergenic
1058903222 9:109459913-109459935 TCCCCTGAGAAGCAAGTGGATGG - Intronic
1059295164 9:113263936-113263958 CCTTATAAGGAGCAGGCGGAGGG + Exonic
1060399369 9:123339286-123339308 CCGCCTGAGGAGCGGGGGCATGG - Intergenic
1061035547 9:128112121-128112143 CCTCCTGAGTAGCTGGTAGCTGG - Intergenic
1061227767 9:129290724-129290746 GCACCTGAGTAGCAGGTGCATGG + Intergenic
1061299088 9:129694526-129694548 CCTCCTGGGGAGAAGGTGAAGGG + Intronic
1061441219 9:130605177-130605199 GCTCTTGAGGAGAAGGTGCAGGG + Intronic
1061496974 9:130980697-130980719 TCTAATGAGGAGCAGGTGGATGG - Intergenic
1061931372 9:133834728-133834750 CCTCCTGGTGGGCAGGTGGGAGG + Intronic
1062176455 9:135165922-135165944 GCTCCTAAGCACCAGGTGGAAGG - Intergenic
1062299457 9:135856919-135856941 CATCCTGAAGAGGAGGTGGAGGG - Intronic
1062307006 9:135913291-135913313 CCTTCTGGGGAGGAGTTGGATGG + Intergenic
1062497915 9:136840303-136840325 CTTCCTGAGGAGCACAAGGATGG - Exonic
1185735387 X:2491909-2491931 CCTCCTGAGTGGCAGCTGGAAGG - Intronic
1185977571 X:4738633-4738655 CCTCTTTGGGAGCAGGTGGAAGG + Intergenic
1187736911 X:22314142-22314164 CCACCAGAGGAGGAGGAGGAGGG + Intergenic
1190780491 X:53589914-53589936 CCGCTTGAGGAGAAGGTTGAGGG - Intronic
1191184298 X:57592778-57592800 GCGCCTGAGGAGGAGGCGGAGGG + Exonic
1192235943 X:69296158-69296180 CCACCTCAGGATCAGGTGGATGG - Intergenic
1192564384 X:72151494-72151516 ACTGCACAGGAGCAGGTGGAGGG + Intergenic
1194723912 X:97372626-97372648 CCTTCTCAGGTTCAGGTGGATGG - Intronic
1195112773 X:101664228-101664250 ACTCCTGAAGTCCAGGTGGAAGG + Intergenic
1196420458 X:115515522-115515544 CCTTCTCACCAGCAGGTGGATGG + Intergenic
1196638391 X:118031020-118031042 TCTCCTGAGGAGCAGGGAGTAGG + Intronic
1197149827 X:123207997-123208019 GCTTCTGAGCAGCAGGAGGAAGG - Intronic
1199613826 X:149639716-149639738 CCCCCTGAGGGGCGGGTGGGAGG - Intergenic
1199678609 X:150208306-150208328 CCTCCTCAAAAGCAGATGGAAGG + Intergenic
1200238841 X:154483157-154483179 CTCCCTGAGGGGCAGGTGGTGGG + Intergenic
1201368021 Y:13230142-13230164 CCTACTCAGGAGGAGGTGGTGGG - Intergenic
1201622830 Y:15979580-15979602 TCTCCTGTGGTGCAGGTGGATGG + Intergenic