ID: 1176053638

View in Genome Browser
Species Human (GRCh38)
Location 20:63133744-63133766
Sequence GCTGCCGTGACCCGAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176053638_1176053643 13 Left 1176053638 20:63133744-63133766 CCAGCTCCTCGGGTCACGGCAGC No data
Right 1176053643 20:63133780-63133802 CTCCTCTCATCCCAATCCACTGG No data
1176053638_1176053646 15 Left 1176053638 20:63133744-63133766 CCAGCTCCTCGGGTCACGGCAGC No data
Right 1176053646 20:63133782-63133804 CCTCTCATCCCAATCCACTGGGG No data
1176053638_1176053641 -10 Left 1176053638 20:63133744-63133766 CCAGCTCCTCGGGTCACGGCAGC No data
Right 1176053641 20:63133757-63133779 TCACGGCAGCTCCATAGCAAGGG No data
1176053638_1176053650 29 Left 1176053638 20:63133744-63133766 CCAGCTCCTCGGGTCACGGCAGC No data
Right 1176053650 20:63133796-63133818 CCACTGGGGCCACTGCCAAGAGG No data
1176053638_1176053644 14 Left 1176053638 20:63133744-63133766 CCAGCTCCTCGGGTCACGGCAGC No data
Right 1176053644 20:63133781-63133803 TCCTCTCATCCCAATCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176053638 Original CRISPR GCTGCCGTGACCCGAGGAGC TGG (reversed) Intergenic