ID: 1176055133

View in Genome Browser
Species Human (GRCh38)
Location 20:63141264-63141286
Sequence CAACACGCGTGGGGTGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176055133_1176055140 17 Left 1176055133 20:63141264-63141286 CCTCAGGCACCCCACGCGTGTTG No data
Right 1176055140 20:63141304-63141326 CTTGTCAAGGGCATCGTTAAAGG No data
1176055133_1176055139 5 Left 1176055133 20:63141264-63141286 CCTCAGGCACCCCACGCGTGTTG No data
Right 1176055139 20:63141292-63141314 CAAGCGTGACTTCTTGTCAAGGG No data
1176055133_1176055138 4 Left 1176055133 20:63141264-63141286 CCTCAGGCACCCCACGCGTGTTG No data
Right 1176055138 20:63141291-63141313 CCAAGCGTGACTTCTTGTCAAGG No data
1176055133_1176055141 28 Left 1176055133 20:63141264-63141286 CCTCAGGCACCCCACGCGTGTTG No data
Right 1176055141 20:63141315-63141337 CATCGTTAAAGGAGAACATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176055133 Original CRISPR CAACACGCGTGGGGTGCCTG AGG (reversed) Intergenic
No off target data available for this crispr