ID: 1176055136

View in Genome Browser
Species Human (GRCh38)
Location 20:63141275-63141297
Sequence CGCTTGGCTGTCAACACGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176055136_1176055143 27 Left 1176055136 20:63141275-63141297 CCACGCGTGTTGACAGCCAAGCG No data
Right 1176055143 20:63141325-63141347 GGAGAACATGAGGCCTGCTCGGG No data
1176055136_1176055138 -7 Left 1176055136 20:63141275-63141297 CCACGCGTGTTGACAGCCAAGCG No data
Right 1176055138 20:63141291-63141313 CCAAGCGTGACTTCTTGTCAAGG No data
1176055136_1176055142 26 Left 1176055136 20:63141275-63141297 CCACGCGTGTTGACAGCCAAGCG No data
Right 1176055142 20:63141324-63141346 AGGAGAACATGAGGCCTGCTCGG No data
1176055136_1176055145 29 Left 1176055136 20:63141275-63141297 CCACGCGTGTTGACAGCCAAGCG No data
Right 1176055145 20:63141327-63141349 AGAACATGAGGCCTGCTCGGGGG No data
1176055136_1176055144 28 Left 1176055136 20:63141275-63141297 CCACGCGTGTTGACAGCCAAGCG No data
Right 1176055144 20:63141326-63141348 GAGAACATGAGGCCTGCTCGGGG No data
1176055136_1176055139 -6 Left 1176055136 20:63141275-63141297 CCACGCGTGTTGACAGCCAAGCG No data
Right 1176055139 20:63141292-63141314 CAAGCGTGACTTCTTGTCAAGGG No data
1176055136_1176055140 6 Left 1176055136 20:63141275-63141297 CCACGCGTGTTGACAGCCAAGCG No data
Right 1176055140 20:63141304-63141326 CTTGTCAAGGGCATCGTTAAAGG No data
1176055136_1176055141 17 Left 1176055136 20:63141275-63141297 CCACGCGTGTTGACAGCCAAGCG No data
Right 1176055141 20:63141315-63141337 CATCGTTAAAGGAGAACATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176055136 Original CRISPR CGCTTGGCTGTCAACACGCG TGG (reversed) Intergenic
No off target data available for this crispr