ID: 1176055137

View in Genome Browser
Species Human (GRCh38)
Location 20:63141291-63141313
Sequence CCTTGACAAGAAGTCACGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176055137_1176055140 -10 Left 1176055137 20:63141291-63141313 CCAAGCGTGACTTCTTGTCAAGG No data
Right 1176055140 20:63141304-63141326 CTTGTCAAGGGCATCGTTAAAGG No data
1176055137_1176055141 1 Left 1176055137 20:63141291-63141313 CCAAGCGTGACTTCTTGTCAAGG No data
Right 1176055141 20:63141315-63141337 CATCGTTAAAGGAGAACATGAGG No data
1176055137_1176055143 11 Left 1176055137 20:63141291-63141313 CCAAGCGTGACTTCTTGTCAAGG No data
Right 1176055143 20:63141325-63141347 GGAGAACATGAGGCCTGCTCGGG No data
1176055137_1176055146 21 Left 1176055137 20:63141291-63141313 CCAAGCGTGACTTCTTGTCAAGG No data
Right 1176055146 20:63141335-63141357 AGGCCTGCTCGGGGGCTGAGAGG No data
1176055137_1176055148 28 Left 1176055137 20:63141291-63141313 CCAAGCGTGACTTCTTGTCAAGG No data
Right 1176055148 20:63141342-63141364 CTCGGGGGCTGAGAGGAGAGAGG No data
1176055137_1176055142 10 Left 1176055137 20:63141291-63141313 CCAAGCGTGACTTCTTGTCAAGG No data
Right 1176055142 20:63141324-63141346 AGGAGAACATGAGGCCTGCTCGG No data
1176055137_1176055144 12 Left 1176055137 20:63141291-63141313 CCAAGCGTGACTTCTTGTCAAGG No data
Right 1176055144 20:63141326-63141348 GAGAACATGAGGCCTGCTCGGGG No data
1176055137_1176055145 13 Left 1176055137 20:63141291-63141313 CCAAGCGTGACTTCTTGTCAAGG No data
Right 1176055145 20:63141327-63141349 AGAACATGAGGCCTGCTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176055137 Original CRISPR CCTTGACAAGAAGTCACGCT TGG (reversed) Intergenic
No off target data available for this crispr