ID: 1176055142

View in Genome Browser
Species Human (GRCh38)
Location 20:63141324-63141346
Sequence AGGAGAACATGAGGCCTGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176055134_1176055142 28 Left 1176055134 20:63141273-63141295 CCCCACGCGTGTTGACAGCCAAG No data
Right 1176055142 20:63141324-63141346 AGGAGAACATGAGGCCTGCTCGG No data
1176055137_1176055142 10 Left 1176055137 20:63141291-63141313 CCAAGCGTGACTTCTTGTCAAGG No data
Right 1176055142 20:63141324-63141346 AGGAGAACATGAGGCCTGCTCGG No data
1176055135_1176055142 27 Left 1176055135 20:63141274-63141296 CCCACGCGTGTTGACAGCCAAGC No data
Right 1176055142 20:63141324-63141346 AGGAGAACATGAGGCCTGCTCGG No data
1176055136_1176055142 26 Left 1176055136 20:63141275-63141297 CCACGCGTGTTGACAGCCAAGCG No data
Right 1176055142 20:63141324-63141346 AGGAGAACATGAGGCCTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176055142 Original CRISPR AGGAGAACATGAGGCCTGCT CGG Intergenic
No off target data available for this crispr