ID: 1176055146

View in Genome Browser
Species Human (GRCh38)
Location 20:63141335-63141357
Sequence AGGCCTGCTCGGGGGCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176055137_1176055146 21 Left 1176055137 20:63141291-63141313 CCAAGCGTGACTTCTTGTCAAGG No data
Right 1176055146 20:63141335-63141357 AGGCCTGCTCGGGGGCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176055146 Original CRISPR AGGCCTGCTCGGGGGCTGAG AGG Intergenic
No off target data available for this crispr