ID: 1176055524

View in Genome Browser
Species Human (GRCh38)
Location 20:63144476-63144498
Sequence CCTCCGTGTCACGAAGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176055524_1176055530 11 Left 1176055524 20:63144476-63144498 CCATGCCCTTCGTGACACGGAGG No data
Right 1176055530 20:63144510-63144532 ACCAGTCGAATTGAAATTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176055524 Original CRISPR CCTCCGTGTCACGAAGGGCA TGG (reversed) Intergenic
No off target data available for this crispr