ID: 1176055530

View in Genome Browser
Species Human (GRCh38)
Location 20:63144510-63144532
Sequence ACCAGTCGAATTGAAATTTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176055524_1176055530 11 Left 1176055524 20:63144476-63144498 CCATGCCCTTCGTGACACGGAGG No data
Right 1176055530 20:63144510-63144532 ACCAGTCGAATTGAAATTTTCGG No data
1176055526_1176055530 6 Left 1176055526 20:63144481-63144503 CCCTTCGTGACACGGAGGTAGAT No data
Right 1176055530 20:63144510-63144532 ACCAGTCGAATTGAAATTTTCGG No data
1176055527_1176055530 5 Left 1176055527 20:63144482-63144504 CCTTCGTGACACGGAGGTAGATC No data
Right 1176055530 20:63144510-63144532 ACCAGTCGAATTGAAATTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176055530 Original CRISPR ACCAGTCGAATTGAAATTTT CGG Intergenic
No off target data available for this crispr