ID: 1176056069

View in Genome Browser
Species Human (GRCh38)
Location 20:63149972-63149994
Sequence AAGTGTGTAAGAGGGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176056064_1176056069 -5 Left 1176056064 20:63149954-63149976 CCTCGAGGCTGGAGAGGGAAGTG No data
Right 1176056069 20:63149972-63149994 AAGTGTGTAAGAGGGGCACAGGG No data
1176056063_1176056069 -4 Left 1176056063 20:63149953-63149975 CCCTCGAGGCTGGAGAGGGAAGT No data
Right 1176056069 20:63149972-63149994 AAGTGTGTAAGAGGGGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176056069 Original CRISPR AAGTGTGTAAGAGGGGCACA GGG Intergenic
No off target data available for this crispr