ID: 1176058652

View in Genome Browser
Species Human (GRCh38)
Location 20:63162106-63162128
Sequence CTCTATCAGCACGGGCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176058652_1176058659 16 Left 1176058652 20:63162106-63162128 CCAGAGAGCCCGTGCTGATAGAG No data
Right 1176058659 20:63162145-63162167 CCTGCACCCAGCATCCAGCGTGG No data
1176058652_1176058661 18 Left 1176058652 20:63162106-63162128 CCAGAGAGCCCGTGCTGATAGAG No data
Right 1176058661 20:63162147-63162169 TGCACCCAGCATCCAGCGTGGGG No data
1176058652_1176058664 23 Left 1176058652 20:63162106-63162128 CCAGAGAGCCCGTGCTGATAGAG No data
Right 1176058664 20:63162152-63162174 CCAGCATCCAGCGTGGGGCCTGG No data
1176058652_1176058660 17 Left 1176058652 20:63162106-63162128 CCAGAGAGCCCGTGCTGATAGAG No data
Right 1176058660 20:63162146-63162168 CTGCACCCAGCATCCAGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176058652 Original CRISPR CTCTATCAGCACGGGCTCTC TGG (reversed) Intergenic
No off target data available for this crispr