ID: 1176061021

View in Genome Browser
Species Human (GRCh38)
Location 20:63173049-63173071
Sequence TGCCGCCTGCTCCCACTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176061018_1176061021 6 Left 1176061018 20:63173020-63173042 CCTGAGGAAGGAGAGGGCGCCCT No data
Right 1176061021 20:63173049-63173071 TGCCGCCTGCTCCCACTTAGAGG No data
1176061012_1176061021 26 Left 1176061012 20:63173000-63173022 CCATGGGGGACACCTGAGGGCCT No data
Right 1176061021 20:63173049-63173071 TGCCGCCTGCTCCCACTTAGAGG No data
1176061015_1176061021 14 Left 1176061015 20:63173012-63173034 CCTGAGGGCCTGAGGAAGGAGAG No data
Right 1176061021 20:63173049-63173071 TGCCGCCTGCTCCCACTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176061021 Original CRISPR TGCCGCCTGCTCCCACTTAG AGG Intergenic
No off target data available for this crispr