ID: 1176062028

View in Genome Browser
Species Human (GRCh38)
Location 20:63176647-63176669
Sequence CTCCGAGGGCAGATGGCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176062021_1176062028 -3 Left 1176062021 20:63176627-63176649 CCAGGGAGGCCCAGGCTCTGCTC No data
Right 1176062028 20:63176647-63176669 CTCCGAGGGCAGATGGCGCAGGG No data
1176062019_1176062028 4 Left 1176062019 20:63176620-63176642 CCTGCTCCCAGGGAGGCCCAGGC No data
Right 1176062028 20:63176647-63176669 CTCCGAGGGCAGATGGCGCAGGG No data
1176062020_1176062028 -2 Left 1176062020 20:63176626-63176648 CCCAGGGAGGCCCAGGCTCTGCT No data
Right 1176062028 20:63176647-63176669 CTCCGAGGGCAGATGGCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176062028 Original CRISPR CTCCGAGGGCAGATGGCGCA GGG Intergenic
No off target data available for this crispr