ID: 1176063806

View in Genome Browser
Species Human (GRCh38)
Location 20:63183818-63183840
Sequence CAGGCCCACCTGGACCTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176063806_1176063816 7 Left 1176063806 20:63183818-63183840 CCACCAAGGTCCAGGTGGGCCTG No data
Right 1176063816 20:63183848-63183870 AGGACCTCCATGGGTAGAGAGGG No data
1176063806_1176063819 15 Left 1176063806 20:63183818-63183840 CCACCAAGGTCCAGGTGGGCCTG No data
Right 1176063819 20:63183856-63183878 CATGGGTAGAGAGGGTAGTCTGG No data
1176063806_1176063821 26 Left 1176063806 20:63183818-63183840 CCACCAAGGTCCAGGTGGGCCTG No data
Right 1176063821 20:63183867-63183889 AGGGTAGTCTGGGCTCTGCCTGG No data
1176063806_1176063815 6 Left 1176063806 20:63183818-63183840 CCACCAAGGTCCAGGTGGGCCTG No data
Right 1176063815 20:63183847-63183869 CAGGACCTCCATGGGTAGAGAGG No data
1176063806_1176063814 -2 Left 1176063806 20:63183818-63183840 CCACCAAGGTCCAGGTGGGCCTG No data
Right 1176063814 20:63183839-63183861 TGCAGGGACAGGACCTCCATGGG No data
1176063806_1176063813 -3 Left 1176063806 20:63183818-63183840 CCACCAAGGTCCAGGTGGGCCTG No data
Right 1176063813 20:63183838-63183860 CTGCAGGGACAGGACCTCCATGG No data
1176063806_1176063820 16 Left 1176063806 20:63183818-63183840 CCACCAAGGTCCAGGTGGGCCTG No data
Right 1176063820 20:63183857-63183879 ATGGGTAGAGAGGGTAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176063806 Original CRISPR CAGGCCCACCTGGACCTTGG TGG (reversed) Intergenic
No off target data available for this crispr