ID: 1176063816

View in Genome Browser
Species Human (GRCh38)
Location 20:63183848-63183870
Sequence AGGACCTCCATGGGTAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176063800_1176063816 29 Left 1176063800 20:63183796-63183818 CCTAGGAATGGTGCCACAAGCAC No data
Right 1176063816 20:63183848-63183870 AGGACCTCCATGGGTAGAGAGGG No data
1176063806_1176063816 7 Left 1176063806 20:63183818-63183840 CCACCAAGGTCCAGGTGGGCCTG No data
Right 1176063816 20:63183848-63183870 AGGACCTCCATGGGTAGAGAGGG No data
1176063810_1176063816 -3 Left 1176063810 20:63183828-63183850 CCAGGTGGGCCTGCAGGGACAGG No data
Right 1176063816 20:63183848-63183870 AGGACCTCCATGGGTAGAGAGGG No data
1176063807_1176063816 4 Left 1176063807 20:63183821-63183843 CCAAGGTCCAGGTGGGCCTGCAG No data
Right 1176063816 20:63183848-63183870 AGGACCTCCATGGGTAGAGAGGG No data
1176063802_1176063816 16 Left 1176063802 20:63183809-63183831 CCACAAGCACCACCAAGGTCCAG No data
Right 1176063816 20:63183848-63183870 AGGACCTCCATGGGTAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176063816 Original CRISPR AGGACCTCCATGGGTAGAGA GGG Intergenic
No off target data available for this crispr