ID: 1176065522

View in Genome Browser
Species Human (GRCh38)
Location 20:63192446-63192468
Sequence AGCGCCTCAGCCGGGCGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176065522_1176065527 25 Left 1176065522 20:63192446-63192468 CCACCGCGCCCGGCTGAGGCGCT No data
Right 1176065527 20:63192494-63192516 GGAGTCTCGCTCTGTCACCCAGG No data
1176065522_1176065526 4 Left 1176065522 20:63192446-63192468 CCACCGCGCCCGGCTGAGGCGCT No data
Right 1176065526 20:63192473-63192495 TTTTATTTTTTTTTTTGAGACGG No data
1176065522_1176065528 29 Left 1176065522 20:63192446-63192468 CCACCGCGCCCGGCTGAGGCGCT No data
Right 1176065528 20:63192498-63192520 TCTCGCTCTGTCACCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176065522 Original CRISPR AGCGCCTCAGCCGGGCGCGG TGG (reversed) Intergenic