ID: 1176065522 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:63192446-63192468 |
| Sequence | AGCGCCTCAGCCGGGCGCGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1176065522_1176065527 | 25 | Left | 1176065522 | 20:63192446-63192468 | CCACCGCGCCCGGCTGAGGCGCT | No data | ||
| Right | 1176065527 | 20:63192494-63192516 | GGAGTCTCGCTCTGTCACCCAGG | No data | ||||
| 1176065522_1176065526 | 4 | Left | 1176065522 | 20:63192446-63192468 | CCACCGCGCCCGGCTGAGGCGCT | No data | ||
| Right | 1176065526 | 20:63192473-63192495 | TTTTATTTTTTTTTTTGAGACGG | No data | ||||
| 1176065522_1176065528 | 29 | Left | 1176065522 | 20:63192446-63192468 | CCACCGCGCCCGGCTGAGGCGCT | No data | ||
| Right | 1176065528 | 20:63192498-63192520 | TCTCGCTCTGTCACCCAGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1176065522 | Original CRISPR | AGCGCCTCAGCCGGGCGCGG TGG (reversed) | Intergenic | ||