ID: 1176065527

View in Genome Browser
Species Human (GRCh38)
Location 20:63192494-63192516
Sequence GGAGTCTCGCTCTGTCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176065524_1176065527 17 Left 1176065524 20:63192454-63192476 CCCGGCTGAGGCGCTTCTTTTTT No data
Right 1176065527 20:63192494-63192516 GGAGTCTCGCTCTGTCACCCAGG No data
1176065525_1176065527 16 Left 1176065525 20:63192455-63192477 CCGGCTGAGGCGCTTCTTTTTTA No data
Right 1176065527 20:63192494-63192516 GGAGTCTCGCTCTGTCACCCAGG No data
1176065522_1176065527 25 Left 1176065522 20:63192446-63192468 CCACCGCGCCCGGCTGAGGCGCT No data
Right 1176065527 20:63192494-63192516 GGAGTCTCGCTCTGTCACCCAGG No data
1176065523_1176065527 22 Left 1176065523 20:63192449-63192471 CCGCGCCCGGCTGAGGCGCTTCT No data
Right 1176065527 20:63192494-63192516 GGAGTCTCGCTCTGTCACCCAGG No data
1176065521_1176065527 26 Left 1176065521 20:63192445-63192467 CCCACCGCGCCCGGCTGAGGCGC No data
Right 1176065527 20:63192494-63192516 GGAGTCTCGCTCTGTCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176065527 Original CRISPR GGAGTCTCGCTCTGTCACCC AGG Intergenic