ID: 1176066840

View in Genome Browser
Species Human (GRCh38)
Location 20:63202212-63202234
Sequence ACTTAGACCAGGTGGCCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176066840_1176066846 3 Left 1176066840 20:63202212-63202234 CCACCGGGCCACCTGGTCTAAGT 0: 1
1: 0
2: 1
3: 11
4: 66
Right 1176066846 20:63202238-63202260 GCACCAAGGACACATCTGCATGG 0: 1
1: 0
2: 0
3: 20
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176066840 Original CRISPR ACTTAGACCAGGTGGCCCGG TGG (reversed) Intronic