ID: 1176066840 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:63202212-63202234 |
| Sequence | ACTTAGACCAGGTGGCCCGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 79 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 11, 4: 66} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1176066840_1176066846 | 3 | Left | 1176066840 | 20:63202212-63202234 | CCACCGGGCCACCTGGTCTAAGT | 0: 1 1: 0 2: 1 3: 11 4: 66 |
||
| Right | 1176066846 | 20:63202238-63202260 | GCACCAAGGACACATCTGCATGG | 0: 1 1: 0 2: 0 3: 20 4: 159 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1176066840 | Original CRISPR | ACTTAGACCAGGTGGCCCGG TGG (reversed) | Intronic | ||