ID: 1176066846

View in Genome Browser
Species Human (GRCh38)
Location 20:63202238-63202260
Sequence GCACCAAGGACACATCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 159}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176066835_1176066846 20 Left 1176066835 20:63202195-63202217 CCTGCCGCATCTGCTCACCACCG 0: 1
1: 0
2: 0
3: 12
4: 109
Right 1176066846 20:63202238-63202260 GCACCAAGGACACATCTGCATGG 0: 1
1: 0
2: 0
3: 20
4: 159
1176066844_1176066846 -8 Left 1176066844 20:63202223-63202245 CCTGGTCTAAGTACGGCACCAAG 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1176066846 20:63202238-63202260 GCACCAAGGACACATCTGCATGG 0: 1
1: 0
2: 0
3: 20
4: 159
1176066840_1176066846 3 Left 1176066840 20:63202212-63202234 CCACCGGGCCACCTGGTCTAAGT 0: 1
1: 0
2: 1
3: 11
4: 66
Right 1176066846 20:63202238-63202260 GCACCAAGGACACATCTGCATGG 0: 1
1: 0
2: 0
3: 20
4: 159
1176066838_1176066846 16 Left 1176066838 20:63202199-63202221 CCGCATCTGCTCACCACCGGGCC 0: 1
1: 0
2: 0
3: 21
4: 316
Right 1176066846 20:63202238-63202260 GCACCAAGGACACATCTGCATGG 0: 1
1: 0
2: 0
3: 20
4: 159
1176066843_1176066846 -5 Left 1176066843 20:63202220-63202242 CCACCTGGTCTAAGTACGGCACC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1176066846 20:63202238-63202260 GCACCAAGGACACATCTGCATGG 0: 1
1: 0
2: 0
3: 20
4: 159
1176066841_1176066846 0 Left 1176066841 20:63202215-63202237 CCGGGCCACCTGGTCTAAGTACG 0: 1
1: 1
2: 0
3: 2
4: 35
Right 1176066846 20:63202238-63202260 GCACCAAGGACACATCTGCATGG 0: 1
1: 0
2: 0
3: 20
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176066846 Original CRISPR GCACCAAGGACACATCTGCA TGG Intronic