ID: 1176067405

View in Genome Browser
Species Human (GRCh38)
Location 20:63205414-63205436
Sequence CTCCCATCCTAGAATACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 109}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176067396_1176067405 9 Left 1176067396 20:63205382-63205404 CCAATGACCCGGCCACCACTTCC 0: 1
1: 0
2: 1
3: 11
4: 167
Right 1176067405 20:63205414-63205436 CTCCCATCCTAGAATACTGAGGG 0: 1
1: 0
2: 1
3: 5
4: 109
1176067400_1176067405 -6 Left 1176067400 20:63205397-63205419 CCACTTCCTGCCTCCTGCTCCCA 0: 1
1: 2
2: 21
3: 247
4: 1577
Right 1176067405 20:63205414-63205436 CTCCCATCCTAGAATACTGAGGG 0: 1
1: 0
2: 1
3: 5
4: 109
1176067397_1176067405 2 Left 1176067397 20:63205389-63205411 CCCGGCCACCACTTCCTGCCTCC 0: 1
1: 0
2: 11
3: 97
4: 692
Right 1176067405 20:63205414-63205436 CTCCCATCCTAGAATACTGAGGG 0: 1
1: 0
2: 1
3: 5
4: 109
1176067398_1176067405 1 Left 1176067398 20:63205390-63205412 CCGGCCACCACTTCCTGCCTCCT 0: 1
1: 1
2: 7
3: 121
4: 978
Right 1176067405 20:63205414-63205436 CTCCCATCCTAGAATACTGAGGG 0: 1
1: 0
2: 1
3: 5
4: 109
1176067399_1176067405 -3 Left 1176067399 20:63205394-63205416 CCACCACTTCCTGCCTCCTGCTC 0: 1
1: 0
2: 16
3: 186
4: 1714
Right 1176067405 20:63205414-63205436 CTCCCATCCTAGAATACTGAGGG 0: 1
1: 0
2: 1
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176067405 Original CRISPR CTCCCATCCTAGAATACTGA GGG Intronic
902980480 1:20119280-20119302 CTACCATGCTAGGAGACTGACGG + Intronic
903156265 1:21445775-21445797 CTCCCATTCCAGAATCCTGTAGG + Intronic
910501144 1:87891919-87891941 ATCCCAAACTAGAATTCTGAAGG + Intergenic
913600915 1:120420678-120420700 CTCCCATTCCAGAATCCTGTAGG + Intergenic
914086142 1:144455955-144455977 CTCCCATTCCAGAATCCTGTAGG - Intronic
914192034 1:145419906-145419928 CTCCCATTCCAGAATCCTGTAGG - Intergenic
914362049 1:146944120-146944142 CTCCCATTCCAGAATCCTGTAGG + Intronic
914489577 1:148142835-148142857 CTCCCATTCCAGAATCCTGTAGG - Intronic
914589941 1:149097856-149097878 CTCCCATTCCAGAATCCTGTGGG - Intronic
915202958 1:154246702-154246724 CTCCCATCATAGTTTAATGAGGG - Intronic
915518757 1:156429317-156429339 CTCCCAGCCTAGATGTCTGAGGG + Intronic
916688298 1:167167638-167167660 CTCTGATCCTAGAATGCTGGGGG - Intergenic
921911194 1:220551090-220551112 CACCCATCTTAGAAGACAGAAGG - Intronic
1067736732 10:48860395-48860417 CTCCCCTCCTGGCTTACTGAAGG + Intronic
1071895286 10:90059892-90059914 GTCCCATCCCAGGATCCTGAAGG + Intergenic
1078077407 11:8174413-8174435 GGCCCATTCTAGAAGACTGAAGG + Intergenic
1080591261 11:33724730-33724752 CAACCATCCCAGAAAACTGAGGG - Intronic
1081556994 11:44173449-44173471 CAGCCATCCTAAAAAACTGAAGG - Intronic
1081956719 11:47098848-47098870 CTGCCATACTATATTACTGATGG - Intronic
1082104633 11:48208510-48208532 CTCCCATCTAACAATCCTGAAGG + Intergenic
1085012293 11:73149646-73149668 CTCCCCTCCTAGAATACTACAGG - Intergenic
1094797698 12:33994956-33994978 GCCCCACCCTAGAAGACTGAAGG - Intergenic
1095110424 12:38288885-38288907 GCCCCATCCTAGAAGACTGAAGG - Intergenic
1100991484 12:100255970-100255992 CTCACATCCTAAAATACTAAGGG + Intronic
1103352879 12:120297407-120297429 CACCCATTCTAGAATTCTCAAGG - Intergenic
1110150648 13:72248972-72248994 CTTCCATCCGAGAATCCTAAAGG - Intergenic
1112092411 13:96095322-96095344 CTCCCATTCTTAAATAATGATGG + Intronic
1112375049 13:98831505-98831527 CTCCCTTCATAGAATGTTGAGGG + Exonic
1114845923 14:26321710-26321732 CTCCCAAACCAGAACACTGAAGG - Intergenic
1117794153 14:59374621-59374643 CTCCCATCCTGGAAGAGTCAGGG - Intergenic
1121317272 14:92969777-92969799 CTCCCATCCAAAAATAAGGATGG - Intronic
1121418695 14:93797335-93797357 CTCAGCTCTTAGAATACTGACGG - Intergenic
1124018082 15:25895226-25895248 CTCTATTCCTAGTATACTGAGGG + Intergenic
1127894643 15:63285965-63285987 CTTAAATCCTATAATACTGATGG - Intronic
1130352229 15:83102773-83102795 CTCACTTCTTAGAATAATGACGG + Intergenic
1133680117 16:8113386-8113408 CTCCTATCCCAGAATGCTCAGGG + Intergenic
1135493065 16:22926475-22926497 GTCCCTTCCTAGAAGCCTGAGGG - Intergenic
1146414734 17:32621530-32621552 CTCCTAGCTTAGAAGACTGATGG + Intronic
1147218421 17:38914239-38914261 CTCCCATCCTGGGATCTTGAGGG + Intronic
1149325390 17:55524811-55524833 CTTCAATCCTGGAATAGTGAAGG + Intergenic
1156942469 18:42785835-42785857 CACTCATCAGAGAATACTGACGG + Intronic
1159216915 18:65404224-65404246 CTCCTATCCTAGTAGTCTGAAGG - Intergenic
1162940919 19:14008605-14008627 ATCCCATCCTAGAATGCAAAGGG - Intergenic
1165306483 19:35005790-35005812 CTCCCATCCTGGACTACTCTGGG - Intronic
1165685890 19:37819546-37819568 TTCCCATCTTAGAAGATTGAAGG - Intergenic
1165853545 19:38865929-38865951 CTCTGATCCTAGAATGCTCAGGG - Intergenic
1167432333 19:49461755-49461777 CTCCCAGCCTGGAATCCGGAAGG + Exonic
925960583 2:9011027-9011049 CTCCTGTCCTAGAATAATGTAGG - Intergenic
930524662 2:52512781-52512803 CTCCCCACCCAGAACACTGAGGG + Intergenic
933249103 2:80008527-80008549 CTCCCATGCATGAATACTCACGG - Intronic
939745518 2:145961475-145961497 CAACCCACCTAGAATACTGAGGG - Intergenic
940601790 2:155872586-155872608 CTGCCAACCTAGAACACTGCAGG + Intergenic
940650616 2:156436545-156436567 CTCCCCCCCTAGAATACTAGAGG - Intronic
943646617 2:190413260-190413282 CTCCCATCCTAAAATGCAGCAGG - Intronic
947076236 2:226349030-226349052 ATCACATTCTGGAATACTGAGGG - Intergenic
1169368923 20:5013504-5013526 CTCCCATCGTCCAATGCTGATGG - Intergenic
1170959852 20:21015756-21015778 CTCCCATCCTAGAATACAGTTGG - Intergenic
1171208578 20:23300014-23300036 CTCACATTCTTAAATACTGAAGG - Intergenic
1172483001 20:35282448-35282470 CTCCCATCATAAAATACACAAGG + Intronic
1174423342 20:50415286-50415308 CTCCCCTCCTTGAAGACTGCTGG + Intergenic
1176067405 20:63205414-63205436 CTCCCATCCTAGAATACTGAGGG + Intronic
1177507346 21:22035971-22035993 CTTCCATCCCAGAAAAATGATGG - Intergenic
1178292124 21:31377689-31377711 CTGCCATCCTAGGCTACTAAGGG + Intronic
1183335213 22:37242462-37242484 CTCCCAGCCTCGCATGCTGAGGG - Intronic
949689223 3:6615413-6615435 CTGTCCTCCTAGAATACTCATGG - Intergenic
952569127 3:34693270-34693292 CTTCCTTACTAGAATTCTGAAGG - Intergenic
954905977 3:54063172-54063194 CTGCCATTCTAGAAAACTTAAGG + Intergenic
958114016 3:89190946-89190968 CTCCCATCCTGAGATCCTGAGGG + Intronic
961059050 3:123812969-123812991 CTCCCAGGCTAGATCACTGATGG + Intronic
964670639 3:159221437-159221459 CTGCAGTCCTAGAATTCTGAAGG + Intronic
965983386 3:174721751-174721773 CTCCCAGCCCAGAATACCGCAGG + Intronic
971476769 4:27080069-27080091 CTTCCCTCCTAGAACTCTGAAGG - Intergenic
972195255 4:36646312-36646334 TTCCCATCCTTGAATGCTCAGGG - Intergenic
973890622 4:55364059-55364081 CTCCCCTCCTACAATTCAGAAGG - Exonic
974452046 4:62077150-62077172 CTTTCATTCTAGAATACTAAAGG + Intronic
976995474 4:91427011-91427033 CTAACATCATAGAATAATGATGG + Intronic
979296245 4:119035331-119035353 CTGCCCTCCTAGAAGACTGAGGG - Intronic
979791292 4:124784531-124784553 CTGCTATCACAGAATACTGAAGG - Intergenic
982267950 4:153557353-153557375 TTCCCATCATAAAATACAGAAGG + Intronic
987923584 5:24313341-24313363 CTACCATCAGAGAATACTGTTGG - Intergenic
989276979 5:39600642-39600664 CTCCAATTCTAGCAAACTGAAGG - Intergenic
991655786 5:68902538-68902560 CTCCTCACCTAGAAAACTGAGGG + Intergenic
992927838 5:81608755-81608777 CCCCCATTCTAGAATTCTCAAGG - Intronic
994581028 5:101642121-101642143 CTCCTATCCTGGAATACCGCTGG + Intergenic
995801798 5:116004641-116004663 CTCACCTCCAGGAATACTGAAGG - Intronic
997504491 5:134405978-134406000 CTGCCATCCTAGGCTACTGCTGG - Intronic
1000912504 5:167039116-167039138 CTCCCTTCCTAGAATGCTTCTGG - Intergenic
1002584294 5:180232149-180232171 CCCCCACCCTACAATAGTGAGGG - Intergenic
1003207640 6:4028045-4028067 CTCCCATCCCATAATCCAGAAGG - Intronic
1004465146 6:15878324-15878346 CTCCCATCCCAAATCACTGAAGG + Intergenic
1005034737 6:21545267-21545289 CTCCAATCCTGGAATTCTCAGGG - Intergenic
1005466646 6:26122518-26122540 CTCCCTTCCTAGACAACTGCAGG - Intronic
1008565577 6:52764760-52764782 CTCACCTCCTAGAAAACTGAGGG + Intergenic
1013719841 6:113011457-113011479 CTGCCATCAGAGAAAACTGAAGG - Intergenic
1014413907 6:121160546-121160568 AACCCATACTTGAATACTGATGG + Intronic
1014567352 6:122966073-122966095 ATCCCATACTAGAACAGTGAAGG - Intergenic
1017123537 6:151045667-151045689 CTCCCATCCTGGGATCCTGGTGG + Intronic
1019219915 6:170464991-170465013 CTCCCTTCCTACATTACAGAAGG + Intergenic
1020623068 7:10541749-10541771 CTCTAATCCTAGAAGACAGAAGG - Intergenic
1022279839 7:28896374-28896396 CTATCATCCTAGAGTTCTGATGG - Intergenic
1025247644 7:57329088-57329110 CTCCCCTCCTTGAAGACTGCTGG - Intergenic
1028783850 7:94769392-94769414 CCCCCAACCTAGAATTTTGAAGG - Intergenic
1030265276 7:107614758-107614780 CTCCAATCCCAGGACACTGAGGG + Intronic
1037041994 8:14247336-14247358 CTCCCAACCGATAATACGGATGG + Intronic
1040287721 8:46108996-46109018 CTCCCATCCCAGAATCCTCCAGG - Intergenic
1040333967 8:46406754-46406776 CTCCCATCCCAGAATACCCCAGG + Intergenic
1040334407 8:46408775-46408797 CTCCCATCCTAGAATCCCTCAGG + Intergenic
1045681263 8:104662949-104662971 CTCTGATCCTTAAATACTGAGGG + Intronic
1049771368 8:144383555-144383577 CTGCCAGCCTAGAAGCCTGAGGG - Intronic
1050437169 9:5623242-5623264 TAGCCATCCTAGAATTCTGATGG - Intergenic
1051160524 9:14202468-14202490 ATCCCATTATAGAATATTGATGG + Intronic
1059018538 9:110548010-110548032 CTCCACTCCTAGAAGACAGAGGG + Intronic
1185802628 X:3027372-3027394 CTCCCAGCCTCCAAGACTGACGG - Exonic
1192477510 X:71455934-71455956 CTCACAACCTAGGTTACTGAGGG + Intronic
1192527186 X:71857645-71857667 ATCCCATTCAACAATACTGAGGG - Intergenic
1195700522 X:107702171-107702193 CTCCCATCAGAGAAGTCTGAAGG - Intergenic