ID: 1176067894

View in Genome Browser
Species Human (GRCh38)
Location 20:63208779-63208801
Sequence CTGCTGTGCCTGGGCAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 1, 2: 2, 3: 51, 4: 433}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176067894_1176067898 3 Left 1176067894 20:63208779-63208801 CCAGAGCTGCCCAGGCACAGCAG 0: 1
1: 1
2: 2
3: 51
4: 433
Right 1176067898 20:63208805-63208827 GCCCTGTGCCAAGCATCTCCAGG 0: 1
1: 0
2: 5
3: 21
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176067894 Original CRISPR CTGCTGTGCCTGGGCAGCTC TGG (reversed) Intronic
900154612 1:1198935-1198957 CTGCTGTCCCTGTGGAGCGCAGG - Intergenic
900215319 1:1478561-1478583 CTCCTGTGTCTGCACAGCTCCGG - Intronic
900386804 1:2414367-2414389 CTGCTGTTCCTGGGCAGGTGGGG + Intergenic
900694060 1:3999432-3999454 CTGCTGTGCCCCAGGAGCTCAGG - Intergenic
901201179 1:7468304-7468326 CAGCTGTGCCTGGCAACCTCCGG - Intronic
901312896 1:8283192-8283214 CTGCTGTGTGGGGGCAGCCCGGG + Intergenic
901321621 1:8343637-8343659 CCGCTGTGTGTGGGCCGCTCGGG + Intronic
901323853 1:8355654-8355676 TTGCTGTGCCTGTGCCGCCCTGG - Intronic
901783565 1:11610091-11610113 CCTCTGTGCCTGAGCAACTCAGG + Intergenic
902456436 1:16536736-16536758 CTTCCGGGCCTGGGCATCTCTGG - Intergenic
903840238 1:26233891-26233913 CTGCTGGGCCTGTGCAGGTTGGG - Intergenic
904139872 1:28344334-28344356 CCACTGTGCCTGGCCAGCTGTGG + Intergenic
904292669 1:29497917-29497939 CCCCTGTGACTGGGCCGCTCGGG - Intergenic
904317614 1:29675898-29675920 CTGCTGTGACTGGGGACCTGGGG + Intergenic
904913024 1:33949599-33949621 CTGGTGAGCCAGGGCAGCACAGG - Intronic
905395089 1:37661614-37661636 TGACTGTGCCTGGGCAGCCCCGG - Intergenic
905561346 1:38929611-38929633 TTGATGTGGCTGGGGAGCTCAGG + Intronic
905915044 1:41678744-41678766 ATGCTGAGCCTTGGCAGCCCTGG - Intronic
906208250 1:43998259-43998281 CTACTGTGCTTGGCCAGTTCAGG - Intronic
907267863 1:53273799-53273821 ATGCTCTTCCTGGGAAGCTCAGG + Intronic
908513472 1:64869311-64869333 CTGATGTCCTTGGGCAGTTCTGG + Exonic
908709754 1:67001889-67001911 CTTCTGTGCCTTGGGAGCCCTGG - Exonic
912719820 1:112010803-112010825 CTGCTGGGGCTGGGAAGCTAGGG - Intergenic
912961966 1:114204039-114204061 CTGCTGTGCCTGAGCAGGCAAGG - Intergenic
912985482 1:114424631-114424653 CCGCTGTGCCTGGGTATCCCTGG + Exonic
913326494 1:117632769-117632791 CTGCTGTTCCTGGTCAGATCAGG - Intergenic
914322979 1:146583186-146583208 CTGCTCCCCCTGGGCAGCCCTGG + Intergenic
914334244 1:146700542-146700564 CAGCTGTCCCTGGGTAGCTCAGG + Intergenic
914799160 1:150947481-150947503 CCACTGTGCCTGGCCAGGTCTGG - Intronic
915702841 1:157812224-157812246 ATGGTGTGCCTCAGCAGCTCAGG - Intronic
916578145 1:166085303-166085325 CTGGGGACCCTGGGCAGCTCAGG + Intronic
917011727 1:170481793-170481815 CTGCTGTACCTGGACAGAGCAGG - Intergenic
918077781 1:181183461-181183483 CTGCTGGGGCTGGCCAGCCCTGG + Intergenic
918315085 1:183316594-183316616 CCCCCGTGCCTGGACAGCTCAGG - Intronic
920539355 1:206766531-206766553 ACGCTCTGCCTGGGCAGCCCTGG - Intergenic
922502037 1:226104428-226104450 CTCCAGGGCCTGGGCAGCACTGG - Intergenic
922728215 1:227935876-227935898 CTTCTCTACCTGGGCAGCACAGG + Intronic
922785169 1:228279039-228279061 ACGCTGGGTCTGGGCAGCTCAGG + Intronic
924483764 1:244460621-244460643 ATGCTGTGCCTGGCCAGGTCTGG + Intronic
924483900 1:244461457-244461479 CTGCTGTGGCTGAGCTGCTATGG + Exonic
1063823359 10:9863803-9863825 CCTCTGTGCGTGCGCAGCTCTGG - Intergenic
1065024143 10:21525810-21525832 CTGCTTTTCCTGGGCTGCTGGGG - Intergenic
1065522488 10:26586189-26586211 CTGCTCTTCTTGGGCAGCTTGGG - Intergenic
1065528729 10:26647900-26647922 CTGCTCTTCTTGGGCAGCTTGGG - Intergenic
1066143102 10:32527177-32527199 CTGCTGTGACAGGGCAGCGCTGG + Intronic
1066566376 10:36725764-36725786 ATGCTGAGCTTGGACAGCTCAGG + Intergenic
1067080825 10:43211371-43211393 CTGCTGAGGCTGTGCAGGTCAGG - Intronic
1067222212 10:44352514-44352536 CAGCTGAGCCTGGCCAGCTGTGG + Intergenic
1068875080 10:61987079-61987101 CTGCTTTGGCCTGGCAGCTCTGG - Intronic
1069641785 10:69961140-69961162 CAGCTGTGGCTGGGAAGCCCAGG + Intronic
1069870567 10:71530312-71530334 CGGCTCTGTCTGGCCAGCTCAGG + Intronic
1071296234 10:84222111-84222133 CGCCTATGCCTGGGCAGCCCAGG - Exonic
1072519958 10:96222621-96222643 CTGCTGGGGCAGGGCAGCTGTGG + Intronic
1072735574 10:97876811-97876833 ATGCTGAGCCTGGGTAGCTTGGG + Intronic
1072755201 10:98016002-98016024 AAACTGAGCCTGGGCAGCTCTGG - Intronic
1073041154 10:100607585-100607607 CTGCTATGGCTGGGGAGCTGAGG + Intergenic
1073125327 10:101145754-101145776 CAGGTGTCCCTTGGCAGCTCAGG - Intergenic
1074871259 10:117577861-117577883 CTGCTGTGCGTGGTCAGCGTTGG + Intergenic
1075996286 10:126878801-126878823 CTGATGAGACTGGGGAGCTCGGG + Intergenic
1076529578 10:131135659-131135681 ATGAGCTGCCTGGGCAGCTCAGG - Intronic
1076687233 10:132203704-132203726 GGGCTGAGCCTGGGCAGCTGTGG - Intronic
1077217784 11:1402220-1402242 CTGCTGTGCCTGCCCCGCCCCGG - Intronic
1077324513 11:1957929-1957951 CTGCTGTGTGCGGGCAGCTCCGG + Intronic
1077731640 11:4737354-4737376 CCACTGTGCCTGGCCACCTCTGG - Intronic
1079037770 11:17035847-17035869 TTGCTCTGCCTGTCCAGCTCAGG - Intergenic
1079213104 11:18481351-18481373 CTTCTGTGCCTGGGTGGATCAGG - Intronic
1079290622 11:19184820-19184842 CTGCTCAGCCTGGGCAGCGTTGG - Intronic
1080772675 11:35356397-35356419 CTAATGTTCCTGGGCACCTCTGG + Intronic
1081383728 11:42446503-42446525 CTGCTGTCACTGTGCATCTCAGG - Intergenic
1083336453 11:61924516-61924538 CTGAGGGGCCTGGGCAGCTGTGG - Intergenic
1083632699 11:64103985-64104007 CTGGGGTGACTGGGCAGCACTGG - Exonic
1083990936 11:66245291-66245313 CCACTGTGCCTGGCCACCTCTGG - Intergenic
1084172507 11:67407265-67407287 CTACTGTCCCTGAGAAGCTCAGG - Intronic
1084738396 11:71121008-71121030 ATGCTGTGTCTGTGCAGCACGGG + Intronic
1084858500 11:72003674-72003696 TGGCTGTGCCTGAGCAGCTCTGG + Intronic
1086947161 11:92854346-92854368 GAGCTGTGGCTGGGCAGCTGTGG + Intronic
1087036126 11:93758342-93758364 CAGCTGCGCCTGGGCAGTTGGGG - Intronic
1087141674 11:94770131-94770153 CTCCTGGGCCCGGGCAGCTGTGG + Intronic
1088076407 11:105854389-105854411 CTGCTTTGCCAGGGGTGCTCTGG - Intronic
1088785720 11:113180035-113180057 CTGCTGTTCCTGGGTTGCCCAGG - Intronic
1089256631 11:117197691-117197713 CTGCTGTTCCTGGGGAGGTAAGG - Intergenic
1090419975 11:126567964-126567986 CTGTTGTGACTGGGCAACTTGGG - Intronic
1090596129 11:128323028-128323050 CTGCTGTGCCTAGACAACCCTGG - Intergenic
1090780624 11:130003227-130003249 CAGCTGTGCCTGGGTGTCTCGGG + Intergenic
1091186481 11:133652214-133652236 CTCCTTTGCCTGAGCAGCGCTGG - Intergenic
1202807492 11_KI270721v1_random:13106-13128 CTGCTGTGTGCGGGCAGCTCCGG + Intergenic
1092260604 12:6951587-6951609 CTGCCCTGCCTGGGCCGCCCAGG + Exonic
1092294794 12:7189612-7189634 CCGCTGGGCCTGGGCCGCTGCGG + Intronic
1092370859 12:7915841-7915863 AGGCTGGGCCTGGGCTGCTCTGG - Intergenic
1092708246 12:11308251-11308273 CTGTTGTCCCTGGGCAGGTCTGG + Exonic
1093927298 12:24921672-24921694 CTGTTGTTCCTTGTCAGCTCTGG - Intronic
1094125955 12:27022520-27022542 CTTCCGCGACTGGGCAGCTCTGG - Intergenic
1095444961 12:42273955-42273977 CTGCTGGTCCTGGGCAGCAAGGG - Intronic
1095923209 12:47552016-47552038 CTGTTCTTCCTGGTCAGCTCAGG - Intergenic
1096212752 12:49779003-49779025 CGCCTGAGCCTGGGCAGTTCAGG - Intergenic
1096814899 12:54195853-54195875 CTGCTGCGCCTGCTCAGCTCAGG - Intergenic
1096878591 12:54648896-54648918 CTACTGAGGCTGGGAAGCTCTGG - Intergenic
1098230905 12:68370881-68370903 CTGCTGTGCCTGGGCACTGCAGG - Intergenic
1098803113 12:74986103-74986125 CAGCTGTGCCTGGGAAGGTGGGG + Intergenic
1099941387 12:89193203-89193225 TTTGTGTGCCTGGGCAGCACTGG - Intergenic
1101452287 12:104790402-104790424 CTGTGGGGCCTGGGCACCTCAGG - Intergenic
1101797862 12:107992399-107992421 CTGCTGTGTAGGGGAAGCTCAGG + Intergenic
1101958792 12:109232697-109232719 GTGCTGTGCCTCAGCAGGTCAGG - Exonic
1102656115 12:114483739-114483761 GTGCTTTCCCTGGACAGCTCAGG - Intergenic
1102680368 12:114686659-114686681 CTGCTGTGCGTGGGACGCTTGGG - Intergenic
1103524416 12:121558375-121558397 GTGCTGTCCCAGGGCTGCTCAGG - Intronic
1103613407 12:122137689-122137711 CACCCCTGCCTGGGCAGCTCTGG - Intronic
1103715398 12:122942298-122942320 CCACTGTGCCCGGCCAGCTCTGG - Intronic
1104664722 12:130639652-130639674 CAGATGAGTCTGGGCAGCTCGGG + Intronic
1104856631 12:131905248-131905270 CTCCTCTGCGGGGGCAGCTCTGG + Intronic
1107177994 13:37422467-37422489 CTGCTGTGACAGGGCAGCAGAGG - Intergenic
1112206423 13:97328100-97328122 CTGCTGTTCTTGGGCACCTTGGG - Intronic
1112510026 13:100000613-100000635 CTACTGCGCCTGGCCATCTCAGG + Intergenic
1113031915 13:106002696-106002718 CTGCTGTGCCTGCGTAATTCTGG + Intergenic
1113443129 13:110345428-110345450 CTGCTGTTCCTGGGAAGCAGTGG + Intronic
1113459689 13:110473085-110473107 CTGGTGTGCCTGGACAGCCTGGG + Exonic
1113506118 13:110817143-110817165 CTCCTGTGCAGGGGCAGGTCAGG - Intergenic
1113657572 13:112077995-112078017 TTGCTGTGCCTGGGGAGGCCAGG - Intergenic
1113714321 13:112492608-112492630 CTGGTGTGCCTGAGACGCTCTGG + Intronic
1113714365 13:112492798-112492820 CTGGTGTGCCTGAGACGCTCTGG + Intronic
1113714527 13:112493594-112493616 CTGGTGTGCCTGAGATGCTCTGG + Intronic
1113725956 13:112601899-112601921 CTGCTGTGCCTCTGTAGCCCCGG + Intergenic
1115245135 14:31287086-31287108 CTGCTGTCCATGGACAGCTCAGG + Intergenic
1117521339 14:56554192-56554214 CAGCTGTGCCAGGGCACCTGGGG - Intronic
1117991198 14:61435551-61435573 CCACTGTGCCTGGCCAGCTCCGG - Intronic
1118971697 14:70642628-70642650 CTGCTGTGACTGTGTTGCTCTGG + Intronic
1119166862 14:72501898-72501920 TCGCTGTGCATGGGCAGCTCAGG - Intronic
1120575380 14:86174912-86174934 CTCATGTTCTTGGGCAGCTCTGG - Intergenic
1120723018 14:87907659-87907681 CTCCGGTGCCTGGCCTGCTCTGG - Intronic
1121115447 14:91339712-91339734 CTGCAGTGCATGGTCACCTCGGG - Intronic
1121485943 14:94314401-94314423 ATGCTGTCCCTGGGCACCTGTGG - Exonic
1121610339 14:95274387-95274409 CTGCTGTGCATGGGCAGGGGTGG - Intronic
1122027127 14:98886188-98886210 CTGCAGTGCATGGGCAGAGCAGG - Intergenic
1122067777 14:99185500-99185522 CTCCTTGGCCTGGGCACCTCCGG - Intronic
1122091141 14:99341355-99341377 CAGCTGTGCCTCTGCACCTCAGG + Intergenic
1122206735 14:100151403-100151425 CAGCTGAGCATGGGCAGCACAGG + Intronic
1122345491 14:101056162-101056184 CTGCACAGCCTGGGCAGCTTGGG - Intergenic
1122878716 14:104680406-104680428 GTGCTGTGGCTGGGCCGGTCTGG - Intergenic
1123416034 15:20096150-20096172 CTTCTGTGCCTGGACAGCAGAGG + Intergenic
1123525372 15:21103259-21103281 CTTCTGTGCCTGGACAGCAGAGG + Intergenic
1124023943 15:25947508-25947530 ATGCTGAGCTTGGACAGCTCGGG - Intergenic
1124341354 15:28891296-28891318 CTGCTGTGACGGGGCAGTGCTGG + Intronic
1124365003 15:29064882-29064904 CCCCTGAGCCTGAGCAGCTCTGG + Intronic
1124982380 15:34578530-34578552 CTGCTGTGACGGGGCAGTGCTGG - Intronic
1125155484 15:36580004-36580026 CAGCAGTGCCTGGGCCGCCCAGG + Intronic
1125786825 15:42326043-42326065 CCGCTGTGCCTGGCCAGCATTGG + Intronic
1127475110 15:59325740-59325762 CTGCTGTGCTTGGTGAGCACAGG + Intronic
1128457322 15:67838960-67838982 CCGCTGTCCCTGGGTGGCTCCGG + Intergenic
1128539056 15:68512266-68512288 TTGCTGTCCCTGGGCTGCTTTGG - Intergenic
1128700596 15:69801379-69801401 CTGCAGTGGCTGGGGAGCTTGGG - Intergenic
1129189022 15:73927016-73927038 CTGCTGGGCCTGGGGCGCGCCGG - Exonic
1129205189 15:74033273-74033295 GTGCTGGGCCTGGGCTGCTCCGG - Exonic
1129717500 15:77860689-77860711 CTGCTGCCCCTGGGCCACTCTGG + Intergenic
1130461252 15:84159508-84159530 CTGCTGCCCCTGGGCCACTCTGG - Intergenic
1131640077 15:94283171-94283193 ATGCTTTGGCTGGGCAGCTGAGG + Intronic
1132476834 16:143564-143586 GTTCTGTGCCTGAGCAGCTGAGG - Intergenic
1132573116 16:652647-652669 CCGCTGTGCCAGGGGGGCTCGGG - Intronic
1132720889 16:1315104-1315126 CTGCTGGGACTGCTCAGCTCAGG - Intronic
1133204349 16:4224068-4224090 CTGTGCTCCCTGGGCAGCTCTGG - Intronic
1133439006 16:5805005-5805027 CTGCTGTGACTTGGAGGCTCTGG + Intergenic
1133641359 16:7720505-7720527 CTACTGTGCCTGGCCAGATGTGG - Intergenic
1133924245 16:10181105-10181127 CCGCTGTGCCTGGGGAACTTGGG + Intronic
1134073681 16:11276044-11276066 CTCCTGTGCCTGGGGTGGTCAGG + Intronic
1134745987 16:16588714-16588736 GTGCTCTGCCTGGGCTGCTCAGG + Intergenic
1134999491 16:18765027-18765049 GTGCTCTGCCTGGGCTGCTCAGG - Intergenic
1136025358 16:27464941-27464963 CTCGTGGGCCTGGGCTGCTCAGG - Intronic
1136264978 16:29110822-29110844 CAGCTGTGCCTGGGAGGGTCGGG - Intergenic
1136676613 16:31914140-31914162 CTGCTGTGATAGGGCAGCACTGG + Intronic
1138319797 16:56102301-56102323 CTGCTATGGCTTGTCAGCTCTGG + Intergenic
1138510991 16:57508328-57508350 CTGCTGCCCCTGGGCTGCTGTGG + Intergenic
1139562091 16:67749588-67749610 CTGCTGGGCCTGGTGAGCTTAGG - Intronic
1139999374 16:71010690-71010712 CAGCTGTCCCTGGGTAGCTCAGG - Intronic
1140010581 16:71127664-71127686 CTGCTACCCCTGGGCAGCCCTGG - Intronic
1141535008 16:84673125-84673147 CAGCTGTGCCTGGCTTGCTCCGG + Intergenic
1141600658 16:85124219-85124241 CGGATGTGCCCGGGCCGCTCTGG - Intergenic
1141667957 16:85475597-85475619 CTGCAGTGCCTGGGCAATTCTGG + Intergenic
1141705394 16:85661784-85661806 CGGCTCTCCCTGAGCAGCTCGGG - Intronic
1141732474 16:85832142-85832164 CTGCTGTGCCTGGCCTGTTTTGG - Intergenic
1141746838 16:85931666-85931688 CAGCTGTGCCTGCTCAGCCCGGG + Intergenic
1141924795 16:87160951-87160973 CTGCTGAGACTGGCCAGCTTTGG - Intronic
1142003694 16:87679116-87679138 CAGCTGAGCCTGGCCAGCTGGGG - Intronic
1142010352 16:87710820-87710842 CTGCTGTGCCTGTGCTGGGCTGG + Intronic
1142054000 16:87980507-87980529 CAGCTGTGCCTGGGAGGGTCGGG + Intronic
1142848793 17:2694584-2694606 CGGCGGTGCTTGGGCTGCTCAGG - Intronic
1142864379 17:2781451-2781473 TTGCTGTGTCTGGACATCTCTGG + Intronic
1143082058 17:4389093-4389115 TTGCTGTGGCCGGGCATCTCGGG + Intergenic
1143199815 17:5104689-5104711 CTGCAGTGCCTGACCAGTTCCGG - Intergenic
1144735887 17:17555280-17555302 CTGCTGTCTCCAGGCAGCTCTGG - Intronic
1145250694 17:21295495-21295517 CGGCTGCACCTGGGCAGCCCTGG + Intronic
1145255969 17:21322584-21322606 CTGCTGGCCCTGGGCACCACAGG + Intergenic
1145757398 17:27402769-27402791 CTGCTGGGCCTGGTCCACTCCGG + Intergenic
1146687643 17:34852347-34852369 GTGCTGGGGCTGTGCAGCTCGGG - Intergenic
1146794478 17:35771772-35771794 CTCCTCTGCCAGGGCACCTCTGG + Intronic
1146844828 17:36175932-36175954 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146857133 17:36263867-36263889 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146863482 17:36324508-36324530 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1146873045 17:36387777-36387799 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146880403 17:36438863-36438885 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147066342 17:37925096-37925118 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1147075928 17:37988402-37988424 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147077875 17:38004657-38004679 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1147087453 17:38067948-38067970 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147093811 17:38128592-38128614 CTGCTGCCCTTGGGCAGCTGTGG + Intergenic
1147103397 17:38191911-38191933 CTGCTGCCCTTGGGCAGCTGTGG - Intergenic
1147340255 17:39749560-39749582 CCACTGTGCCTGGCCACCTCTGG - Intergenic
1147617533 17:41838537-41838559 CCACTGTGCCTGGCCAACTCTGG + Intronic
1148563535 17:48619944-48619966 CGGCTGGGCCTGGGTAGCCCAGG + Intronic
1149010657 17:51853375-51853397 CTGCTGTCCCTGTGCTGGTCAGG + Intronic
1149847971 17:60018380-60018402 CTGCTGCCCTTGGGCAGCTGTGG - Intergenic
1150270715 17:63862708-63862730 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1150274344 17:63886229-63886251 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1150276487 17:63901057-63901079 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1151557739 17:74855029-74855051 CTTCGGTGCCTGGGCAGGGCTGG - Exonic
1151745858 17:76011434-76011456 CTGCAGCCCCTGGGCAGCTCTGG - Intronic
1151827341 17:76530672-76530694 CCTCTCTGCCTGGGCAGCTGTGG + Intronic
1152439279 17:80295476-80295498 CTGTGGTGCTGGGGCAGCTCTGG + Intronic
1152512647 17:80800980-80801002 CTGCTGTCCCTGGGCCACACGGG - Intronic
1152518090 17:80837818-80837840 CGGCTGAGCCTGGGCAGCAAGGG - Intronic
1152695363 17:81741293-81741315 CTGCGGGTCCTGGGCAGCGCCGG - Intergenic
1154394045 18:13970812-13970834 CTGCTGTGCCTCCTCAGCTTTGG - Intergenic
1155429222 18:25738111-25738133 CAGCTGTCCCTGGGCAGATGAGG + Intergenic
1156575085 18:38305495-38305517 CTGCTGTGTGTGAGCAGCTCTGG + Intergenic
1157289007 18:46396918-46396940 CAGCTGTGCCTGGGCAGCCTGGG + Intronic
1157294834 18:46435082-46435104 CTGCTGTTCATCTGCAGCTCAGG - Intronic
1158979878 18:62749669-62749691 CAGCTGTGCCTGCACATCTCTGG + Intronic
1160070601 18:75624694-75624716 CAGCTGTGACTGGGGAGCTCGGG + Intergenic
1160508544 18:79440732-79440754 CTGCTGTGTCTGAACAGCTCCGG + Intronic
1160595125 18:79968031-79968053 TGGCTGTGCCTCGGCGGCTCTGG + Intronic
1160739453 19:679280-679302 CCGCTGTGCCGGGGCCGCCCAGG + Intronic
1160841869 19:1149949-1149971 CTGATGTGCCCGGGAAGCTCAGG + Intronic
1160881544 19:1323152-1323174 CAGCTGTGACTGGCCTGCTCTGG + Intergenic
1160936825 19:1600073-1600095 CTGCTGGGCCCAGGCAACTCAGG - Intronic
1161051388 19:2165477-2165499 CTTCTCTGGTTGGGCAGCTCCGG + Intronic
1161096691 19:2396285-2396307 GTGCTGTACCTGGGGACCTCCGG + Intronic
1161201801 19:3019335-3019357 CAGCTGAGCCTGGGCAGCCAGGG + Exonic
1161288927 19:3482705-3482727 CCGCTGCGACCGGGCAGCTCAGG + Intergenic
1161574453 19:5047976-5047998 CAGCACAGCCTGGGCAGCTCAGG - Intronic
1161596796 19:5154693-5154715 CTGCTGGGCCTGGGTTTCTCCGG - Intergenic
1162021344 19:7869873-7869895 CTGCTGTGGCCGGCCAGGTCTGG + Exonic
1162522473 19:11189948-11189970 GTGTTGTTCCTGGCCAGCTCTGG - Intronic
1162524196 19:11197812-11197834 CTGCTGTCCCTGGGCCGCTGCGG + Intergenic
1162789866 19:13057256-13057278 CGGCTGTGCCTGTGCAGAGCGGG + Intronic
1163748423 19:19061455-19061477 CTGCTTTGGCTGGCCAGCCCTGG - Intergenic
1165093923 19:33400492-33400514 CAGCTGTGCCTGGGCCGGTGTGG + Intronic
1165266038 19:34664431-34664453 CTGGTGTCCCTGGGCAGGGCTGG - Intronic
1165786409 19:38464515-38464537 CTTCAGTGCCTGGGGCGCTCTGG - Intronic
1167017561 19:46850801-46850823 CCGCGGCGACTGGGCAGCTCCGG + Exonic
1167137157 19:47623670-47623692 CAGCTGAGCCTGGGGAGGTCAGG + Intronic
1167220288 19:48194800-48194822 GTGCTGTGCGTGGACGGCTCGGG + Exonic
1167252193 19:48405251-48405273 CAGCAGGGCCTGGGCACCTCTGG - Exonic
1167292201 19:48630494-48630516 CTGCAGCCCGTGGGCAGCTCCGG - Exonic
1167496272 19:49820456-49820478 CTGTGGTGCCCAGGCAGCTCAGG + Intronic
1168634999 19:57989258-57989280 CTCCTTGGCCTGGGCTGCTCTGG - Intronic
925082808 2:1082978-1083000 CTGCTGTGTCTTGGGAGCTGGGG - Intronic
925780614 2:7378487-7378509 CTACTGAGCCCGGCCAGCTCGGG - Intergenic
925962403 2:9030015-9030037 CAGCTGTGCCGGGTCAACTCTGG + Intergenic
926329685 2:11814138-11814160 CTGCTGTGTCTGGGAAGCGGTGG + Intronic
926761942 2:16285785-16285807 CTGCAGTCCCTGGGCAGGTCAGG + Intergenic
928085732 2:28345207-28345229 CCCCTGGGCCTGGGCAGCTTGGG - Intergenic
928168268 2:28986615-28986637 CTGCTCACCCTGGACAGCTCAGG + Intronic
928483959 2:31711030-31711052 CTGCTGTGACAGGGCAGCACTGG - Intergenic
929866391 2:45720819-45720841 CCACTGTGCCTGGCCAGCTCAGG - Intronic
931706425 2:64950319-64950341 CTGCTGTGCCTAGACAGGTTGGG - Intergenic
932340494 2:70960214-70960236 CAGCTGTCCCTGGGCAGCTCAGG + Intronic
932568633 2:72924943-72924965 CTGCTGTTCCTGGGCAAAACTGG + Intronic
932895692 2:75637482-75637504 TTCCTCTGCCTGGGCATCTCAGG + Intergenic
935223535 2:101034980-101035002 AGGCTGTGTCTGGGCATCTCGGG + Intronic
938015063 2:127859980-127860002 GTGCAGTGGCTGGGCAGCTGTGG - Intergenic
938296229 2:130181395-130181417 CTGCCCTGCCTGGGCAGAGCCGG + Intronic
941476079 2:165953548-165953570 CTGCGGTGCCCCGGCTGCTCGGG - Intronic
942408954 2:175686204-175686226 CTGCCTTGCCTGGCCTGCTCTGG + Intergenic
944256035 2:197624672-197624694 CTACTGCGCCTGGCCAGCTGTGG - Intronic
946396101 2:219444482-219444504 CTGCCCAGCCTGGGCTGCTCAGG - Intronic
947106886 2:226676827-226676849 CTGCTGTGGCTGGGGAGGACAGG + Intergenic
947151438 2:227120648-227120670 CCACTGTGCCTGGCCAGCACTGG - Intronic
949027161 2:241771765-241771787 CTGCTGTACACAGGCAGCTCTGG - Intergenic
1169800353 20:9507150-9507172 CTGCTGTGGCTTTGCTGCTCTGG + Intergenic
1171227014 20:23450310-23450332 CTGCTGGGCCAGGGCAGTTTGGG - Intergenic
1171444999 20:25196567-25196589 GGGAAGTGCCTGGGCAGCTCTGG + Intronic
1171484551 20:25477529-25477551 CTGCTGGGCCTTGGGACCTCTGG + Intronic
1172162781 20:32879986-32880008 CTGCTGGGCCTGGGCTGCCCGGG + Intronic
1172929945 20:38579445-38579467 CTGTTGTGCGTGGGCAGAGCAGG - Intergenic
1173409413 20:42796579-42796601 CTTCTGTGGCTGTACAGCTCGGG - Intronic
1173846302 20:46190836-46190858 CTGAGGAGGCTGGGCAGCTCAGG + Intronic
1173927735 20:46793195-46793217 CTGCTGTGCCTATGGAGGTCAGG - Intergenic
1173930594 20:46814737-46814759 CTGCCAAGCCTGGGCAGCTCAGG + Intergenic
1174108799 20:48183443-48183465 CTGCTCTGATTGGTCAGCTCTGG - Intergenic
1174393955 20:50234520-50234542 CCTCTGGGCCTGTGCAGCTCCGG + Intergenic
1174724566 20:52847882-52847904 CTGCTCTGCCTGTGCTGGTCAGG + Intergenic
1175195982 20:57243713-57243735 CTGCGGTGCCCGGGCAGGCCTGG - Intronic
1175601053 20:60273507-60273529 CTTCTCTGCCTGGGCAGCTCGGG + Intergenic
1175960045 20:62631363-62631385 CAGTTGTGCCTGGGGAGCTCTGG + Intergenic
1176067894 20:63208779-63208801 CTGCTGTGCCTGGGCAGCTCTGG - Intronic
1176073707 20:63239179-63239201 CTCCTGGGTGTGGGCAGCTCAGG - Exonic
1178294619 21:31398734-31398756 CGTCTGTGCCTGGGCAGATATGG + Intronic
1178892793 21:36534018-36534040 CTGACGTGCCTGTGCAGCTGAGG + Intronic
1179394379 21:41024685-41024707 CTGCCCTGCTTGGGCTGCTCAGG - Intergenic
1179586204 21:42375519-42375541 CAGCTAGTCCTGGGCAGCTCTGG - Intronic
1179600857 21:42476418-42476440 CTCATGTGACTGGGAAGCTCCGG - Intronic
1179718705 21:43303348-43303370 CTCGTGTCCTTGGGCAGCTCCGG - Intergenic
1179818665 21:43923775-43923797 CTTCTGTCCCTGGGGAGCTGGGG + Intronic
1179821556 21:43940112-43940134 CTGCCAAGCCTGGGCAGCTCAGG + Intronic
1179886214 21:44315281-44315303 CTGCTCTGTGTGAGCAGCTCAGG + Intronic
1180131727 21:45830971-45830993 CTGCTCCGCCTGGGCAGCGTGGG - Intronic
1180197375 21:46205979-46206001 CTGCAGAGCCTGGGCAGCCAGGG - Intronic
1180757522 22:18172958-18172980 CTGCTGAGCCTTCGCAGTTCAGG + Intronic
1181015624 22:20066838-20066860 CTGCTCTTCCTGGGCAGGCCGGG - Intergenic
1181421407 22:22801579-22801601 CTCCTGTCACTGGGCATCTCAGG - Intronic
1181493978 22:23277672-23277694 CTGCTGAGCCTGGGCAAGTCTGG + Intronic
1181582253 22:23834850-23834872 CTGCCGTCCCTGGGCCGCCCTGG + Exonic
1181784554 22:25217602-25217624 CCGCTGTGCCCGGCCAGCCCTGG + Intergenic
1181819250 22:25462759-25462781 CTACAGGGCCTGCGCAGCTCAGG - Intergenic
1182376961 22:29855674-29855696 CTGCTGTGCCTGGGGTGGGCAGG + Intergenic
1182543657 22:31059850-31059872 CTTCTGTGCCTGGACAGCAGAGG - Intergenic
1183481663 22:38068743-38068765 GTGCTGAGCCCGGGCAGCACTGG + Intronic
1183959662 22:41403866-41403888 CTGCTGCGCATGGGCAGGCCAGG - Intergenic
1184841459 22:47054740-47054762 GGGCTGTTCCTGGGCAGGTCGGG + Intronic
1185038394 22:48491092-48491114 CTCGTCTGCCTGGGCAGCTCGGG - Intronic
1185330005 22:50248247-50248269 GTGCGGGGCCTGGGCAGCACGGG + Exonic
949465079 3:4335655-4335677 CCACTGTGCCTGGCCAGCTGGGG - Intronic
950123479 3:10497050-10497072 CTGCTGACCTTGGGCAGCTGTGG + Intronic
950493497 3:13320066-13320088 CTGCTCTGCATGGCCATCTCTGG + Intronic
950612158 3:14133608-14133630 CTGCTGCGCCTGGGCTAATCTGG + Intronic
950642213 3:14355639-14355661 CCACTGTGCCTGGCCAGCCCTGG + Intergenic
950683691 3:14602308-14602330 CTGCTGTGCAGGGGCAGGCCCGG + Intergenic
950955430 3:17047793-17047815 CTGCTGTGACTGTTCAGATCTGG + Intronic
951260016 3:20496183-20496205 CTGCTGTGACAGGGAAGCACTGG + Intergenic
952486050 3:33811170-33811192 CTGCTGTGCCTGGCCCTTTCAGG + Intronic
953367067 3:42354064-42354086 CAGCTCTGCCTGGACAGCCCTGG + Intergenic
954011436 3:47642960-47642982 CTGCTGAGCCTGGGAAGTTGAGG + Intronic
955826945 3:62957436-62957458 CTGGTGTGCCCTAGCAGCTCAGG + Intergenic
956015845 3:64881757-64881779 CTCCTGTGGATGGCCAGCTCTGG - Intergenic
956682355 3:71792503-71792525 CCACTGTGCCTGGCCTGCTCTGG + Intergenic
958733142 3:97979768-97979790 CTGCTGTGCCTGGCCAGGGATGG + Intergenic
961521513 3:127469795-127469817 CTCCTGTGCCAGAGCAGCTGTGG + Intergenic
961790267 3:129371065-129371087 CTGGTGTCCCTGGGCAGCTTCGG + Intergenic
961829482 3:129616115-129616137 CTGCCCTTCCTGGACAGCTCTGG - Intergenic
962105385 3:132383568-132383590 CAGCTGTGCCTGGGAAGGTGGGG + Intergenic
962363447 3:134760825-134760847 CTGCTGTCCTGGGGCACCTCCGG + Intronic
963972856 3:151448477-151448499 CTCCTTGGCCTGGGCAGTTCAGG + Exonic
964730718 3:159861540-159861562 CCGCTGTGCCTGAGCAGATGAGG - Intronic
966294979 3:178409019-178409041 CTTCTGTGCCAGGGTAGCCCAGG - Intergenic
966624942 3:182005702-182005724 TTTCTGTGCCTGGGCCCCTCAGG - Intergenic
966985399 3:185175513-185175535 CTCCTGTTCCTGGGCAGGGCTGG - Intergenic
967837248 3:193974980-193975002 CTGGGCTGCCTGGGCATCTCAGG - Intergenic
968322290 3:197780318-197780340 CTTCTGTGGCTGGCCAGCTTAGG + Intronic
968549056 4:1213148-1213170 CTGCCGTGCCTTGGGAGCCCCGG - Intronic
968873433 4:3253133-3253155 CTGCTGAGGCTGGGCAGGACAGG + Intronic
968938100 4:3624182-3624204 GGGCTGTGCGTGGGCAGCTCTGG - Intergenic
969591673 4:8125878-8125900 CGGCTGTGCGTGGGCAGCCTTGG + Intronic
972338925 4:38133878-38133900 ATGCTGGACCTGGCCAGCTCTGG - Intronic
972414353 4:38824010-38824032 CCGCAGTGCCTGGGCGGCCCGGG - Exonic
973759565 4:54103806-54103828 CTGCCTGGCCTGGGAAGCTCAGG + Intronic
976342836 4:83964308-83964330 CTGGAGTGCCTGGGCAGGACTGG + Intergenic
976800785 4:88989312-88989334 CCACTGTGCCTGGCCAACTCAGG - Intronic
980239377 4:130153567-130153589 GTGCTGAGGCTGGGAAGCTCAGG - Intergenic
980387171 4:132101358-132101380 CTGCTGTACTTGGGGAGCTGAGG - Intergenic
982125730 4:152182403-152182425 CCACTGTGCCTGGCCAACTCTGG + Intergenic
983560348 4:169095162-169095184 CTCCTGTGACTGTGGAGCTCTGG - Exonic
984551862 4:181170450-181170472 CCGCTGTGCCTGGCCAGCTGAGG - Intergenic
984628863 4:182039416-182039438 TTGCTGTGCCATGGCAGCACTGG + Intergenic
984751947 4:183286515-183286537 CTCATGTGGGTGGGCAGCTCGGG + Intronic
984857221 4:184205620-184205642 CTGCTTTCCCAGGGCTGCTCTGG + Intronic
985658573 5:1144320-1144342 TTGCTCTGCCAGGGCAGCTCAGG + Intergenic
986480598 5:8183161-8183183 CTGCTGAGGCTAGGCTGCTCGGG + Intergenic
986769420 5:10958276-10958298 CTGCTGTCCCTGGGCTGAGCTGG + Intergenic
988510446 5:31860208-31860230 CTGCTGTGTCTCGGCAACTCTGG - Intronic
989168210 5:38450891-38450913 CGGCTGTGGATGGCCAGCTCTGG - Intronic
990326079 5:54676634-54676656 GTGCTGTACTTGGGCAACTCAGG - Intergenic
993126793 5:83845239-83845261 ATGAGGTGACTGGGCAGCTCAGG - Intergenic
993709553 5:91211170-91211192 CTGCTGTGACTGTGCTGTTCTGG + Intergenic
993710893 5:91223684-91223706 CTACTGTGCCTGGCCACATCAGG + Intergenic
995528875 5:113073320-113073342 GTGGTATGCCAGGGCAGCTCTGG - Intronic
995708082 5:115005947-115005969 CTGCTGTGTCTCTGCAGGTCTGG - Intergenic
996593922 5:125179750-125179772 CTGCTGTGATTTGGCAGCTCAGG - Intergenic
996794699 5:127332458-127332480 CTGCTGTGCTTGAGAGGCTCTGG - Intronic
997234178 5:132263323-132263345 CAGCTGTGGCAGGGCAGCTGAGG - Intronic
997688967 5:135812788-135812810 CTGGTGTACATGGGCAGCTGGGG - Intergenic
997918851 5:137957772-137957794 CTGTTGAACCAGGGCAGCTCAGG + Intronic
998146453 5:139731785-139731807 CTGCTGTCCCTGGGTACCTGGGG - Intergenic
998564813 5:143207512-143207534 CTGTTGTCCCTGGCCAGCTTTGG - Intronic
998598847 5:143563256-143563278 CTGTTGGGCCTGAGCAGCTGAGG + Intergenic
999102182 5:149035717-149035739 CTCCTGTGCCTGGTCAGTTGTGG - Intronic
999110363 5:149115130-149115152 CTCCTGTGCCTGGTCAGCTGTGG - Intergenic
1001530920 5:172461110-172461132 CTGCTGGGCCTTGGAAGCTGTGG - Intergenic
1001965731 5:175908645-175908667 CTGCTGTGCTGGGGCAGGGCTGG + Intergenic
1002251214 5:177930551-177930573 CTGCTGTGCTGGGGCAGGGCTGG - Intergenic
1002302986 5:178268076-178268098 CTGCTGTGATTCCGCAGCTCAGG - Intronic
1002329025 5:178428973-178428995 GTGCTGGGCCTGGGCAGCACTGG - Intronic
1002460628 5:179371818-179371840 CTCCTGTGTCTGGGCAGGCCTGG - Intergenic
1002641303 5:180631875-180631897 CTGCAGGGCCGGAGCAGCTCAGG + Intronic
1003253638 6:4455548-4455570 CTGCTGTGCTTGGGAAACCCTGG - Intergenic
1003270308 6:4602349-4602371 CAGCTGTGCCTGGGCCCCGCAGG - Intergenic
1003301860 6:4891351-4891373 CAGCTGTGCCTGGTCATCCCAGG - Intronic
1003712548 6:8608903-8608925 CTGCCTGGGCTGGGCAGCTCAGG - Intergenic
1004952618 6:20691261-20691283 CCTCTGGGCCTGGGCATCTCTGG + Intronic
1005385244 6:25279295-25279317 CGGCTGGGCGGGGGCAGCTCCGG - Intronic
1007249801 6:40487990-40488012 CTGCTGTGACTGGGGAGCCTGGG - Intronic
1007593238 6:43036059-43036081 CTGCTGAAGCAGGGCAGCTCAGG - Intergenic
1007699743 6:43759632-43759654 CTGCTGCCCCTGGGGAGGTCTGG + Intergenic
1008642127 6:53474799-53474821 CTGCTGTGACAGGGCAGCACTGG + Intergenic
1009451864 6:63810529-63810551 CAGCTGGGGCTGGCCAGCTCAGG + Intronic
1010284945 6:74065917-74065939 CTGCTGTGCCTGAGGAGCAGAGG + Intergenic
1011195271 6:84774059-84774081 GTGGAGTACCTGGGCAGCTCCGG + Intergenic
1014605021 6:123462914-123462936 CTGCTAACCCTGAGCAGCTCGGG - Intronic
1016002174 6:139052957-139052979 CTACTGTGCCTGGGATCCTCTGG + Intergenic
1017193787 6:151679773-151679795 CAGCTGTGCCTGGGACACTCCGG + Intronic
1019128742 6:169858807-169858829 CTGCTGGGGCTGGCCGGCTCGGG + Intergenic
1019373907 7:678625-678647 CTGTTGTGCCTGGGCCACCCAGG + Intronic
1019525529 7:1478803-1478825 CTGCAGTGGCTGGACAGCCCTGG - Exonic
1019604467 7:1901615-1901637 CTGCTGGGCCAGGGGTGCTCAGG + Intronic
1021633788 7:22671424-22671446 CTGCTCTGCTTGGGCACCTCTGG - Intergenic
1022299265 7:29087621-29087643 CTGCAGTGCCTGCGAAGCTAGGG + Intronic
1022570527 7:31448843-31448865 CAGCTGTGCCTGAACAGCTCAGG + Intergenic
1022693144 7:32677688-32677710 ATCCAGTCCCTGGGCAGCTCTGG - Intergenic
1022840515 7:34159644-34159666 TTGCTGTGCCTGGACTGCTCCGG + Intergenic
1022920819 7:35012248-35012270 ATCCAGTCCCTGGGCAGCTCTGG - Intronic
1023071720 7:36441482-36441504 CTGATGTGCCAGGGCTGCCCTGG + Intronic
1023198298 7:37665782-37665804 CTGCTGGGCCTTGGCAGCATTGG + Intergenic
1023328857 7:39091317-39091339 TTGCTATGCCTGGGGTGCTCAGG + Intronic
1023984826 7:45088488-45088510 CTGCTGGGGCTGGGCCGCTCTGG - Intronic
1024240018 7:47427589-47427611 CTTCTGGCCCTGGGCAGCTGTGG - Intronic
1024251479 7:47508890-47508912 CTTCTGTGGCTGGGAAGCTGGGG - Intronic
1024786339 7:52911602-52911624 CAGCTGTGCCTGGGGGGCACAGG + Intergenic
1026995410 7:74612722-74612744 CTGCTGGGCCTGGGCCGCTGGGG - Intergenic
1029413648 7:100430248-100430270 CTGCTGCGCCTGGGGACCACTGG - Exonic
1032057249 7:128693599-128693621 CAGCAGTGTTTGGGCAGCTCTGG - Intergenic
1033596930 7:142865402-142865424 CTGCTGTGTGTTGGGAGCTCAGG + Intronic
1033629160 7:143140175-143140197 CAGCTCTGCCTGAGGAGCTCAGG + Intergenic
1033659448 7:143393567-143393589 GCGCTGGGCCTGGGGAGCTCTGG - Intronic
1034439029 7:151077209-151077231 CTGCTGTGCGCCAGCAGCTCTGG - Exonic
1035070501 7:156141297-156141319 CTGCTGGGACTGAGCTGCTCTGG - Intergenic
1035138981 7:156738211-156738233 CTGCTGTGACAGGGCAGCATTGG - Intronic
1037629374 8:20639499-20639521 CTGCTGTGCCTTGGGAAGTCTGG + Intergenic
1039562052 8:38520412-38520434 CTGATGTCCCTGAGGAGCTCAGG - Intronic
1039821165 8:41136842-41136864 CTCATGTGCCTGGGCCACTCTGG + Intergenic
1039900733 8:41750777-41750799 CAACAGTGCCTGGGCTGCTCTGG + Intronic
1040545165 8:48393325-48393347 CTGCTGCCCCTGGGAATCTCTGG + Intergenic
1040589593 8:48778245-48778267 CTGCAGTGCCTGGGCAGCTCTGG + Intergenic
1041257893 8:55995186-55995208 CTGCTGTTTCTGGGCAGCAGAGG + Intronic
1042864559 8:73345776-73345798 CTGCAGTGCCCAGGCAGCTGTGG + Intergenic
1048245217 8:132789006-132789028 CTGCTTTACATGGGCAGGTCTGG - Intronic
1048871719 8:138804429-138804451 CTGCTGTGCTTGAGCAGAGCAGG - Intronic
1049361009 8:142212650-142212672 GTACTGGGCCTGGGGAGCTCCGG - Intronic
1049449991 8:142655419-142655441 CTGCTTTCCCTGGGCAGTCCTGG - Intergenic
1049512739 8:143037947-143037969 CAGCTGAGCCTGGCCAGCCCCGG + Intergenic
1049562922 8:143321054-143321076 CTGCTGTGCCGGGGCTGATCGGG - Intronic
1049580433 8:143408279-143408301 CTGCTCTGCCTGAGGCGCTCTGG - Intergenic
1049706867 8:144047164-144047186 CTGCTGAGCCTTGGCCTCTCGGG - Intergenic
1049719865 8:144110829-144110851 CTGCTGAGCCTCGGCTGCCCTGG + Intronic
1049767345 8:144361009-144361031 CTCCTGAGCCTGGGCAGGTGGGG + Exonic
1049778424 8:144416686-144416708 CTGCTGAGCCTGCTCACCTCTGG - Exonic
1049920878 9:363005-363027 CTGCTGTAATTGAGCAGCTCTGG - Intronic
1054453070 9:65413524-65413546 GGGCTGTGCTTGGGCAGCTCTGG + Intergenic
1055140534 9:72872098-72872120 CTCCTGTTCCTGGTAAGCTCTGG - Intergenic
1057220628 9:93256073-93256095 CTGATGTGCCCGGGCACCCCTGG + Intronic
1057227139 9:93298327-93298349 GGGCTGTGCCAGGGAAGCTCAGG + Intronic
1057515409 9:95716318-95716340 CTGGGGTGCCTGGGATGCTCTGG + Intergenic
1057560650 9:96125626-96125648 CTTCTGTAGCTGGGCAGTTCGGG - Intergenic
1058232558 9:102447293-102447315 CTGCTGTGACAGGGGAGCACTGG - Intergenic
1058545915 9:106059998-106060020 CTGCTGTGCCTGGGAGGGTGGGG + Intergenic
1059277432 9:113108318-113108340 CAGGTGTGCGTGGGCAGCCCAGG - Intergenic
1059278819 9:113116233-113116255 CAGGTGTGCGTGGGCAGCCCAGG + Intergenic
1059399467 9:114059773-114059795 CTGCTGTGCCCAAGGAGCTCAGG - Intergenic
1060494616 9:124109223-124109245 CTGCTGTACCTCAGCAACTCCGG - Intergenic
1060950830 9:127601568-127601590 CTGCTATGTTTGGGCACCTCTGG - Intergenic
1061178311 9:129010201-129010223 CTGCTCGGCCTGGGCAGGGCAGG + Exonic
1061222078 9:129258162-129258184 CTGCTGTTACTGGTCACCTCTGG + Intergenic
1061366248 9:130173538-130173560 CTGGTATGCCAGGGCACCTCCGG - Intronic
1062208640 9:135351243-135351265 CGGCTGTGCCTGGGGAGTGCCGG - Intergenic
1062426425 9:136508204-136508226 CTGCTGTGCCCACCCAGCTCGGG - Intronic
1062538550 9:137031536-137031558 CAGGTGTCGCTGGGCAGCTCTGG + Exonic
1062631409 9:137464755-137464777 CGGCTTTGCCTGCTCAGCTCTGG + Intronic
1186718769 X:12280465-12280487 CTGCCATTCCTGGGCAGCCCAGG + Intronic
1189481335 X:41394434-41394456 CTTCTGTGCCTGACCAACTCAGG - Intergenic
1190911273 X:54774668-54774690 CTGCTGTTGCTGGGCAGAGCAGG + Intronic
1190919944 X:54841542-54841564 CTGCTGTTGCTGGGCAGAGCAGG - Intergenic
1192181064 X:68916132-68916154 CTGCTGAGCCAGGGCAGGACTGG - Intergenic
1192495286 X:71612477-71612499 CGGGTGACCCTGGGCAGCTCCGG - Exonic
1192503779 X:71668920-71668942 CTGCTGTGCTTGGGCTCCTTGGG - Intergenic
1192522541 X:71814972-71814994 CTGCTGTGCTTGGGCTCCTTGGG - Intergenic
1196045094 X:111248568-111248590 CTGAAGTGCCTGTCCAGCTCAGG - Exonic
1196253368 X:113487372-113487394 CCACTGTGCCTAGCCAGCTCTGG + Intergenic
1197868115 X:131039712-131039734 CTTCTGTTCCTGGCCAACTCAGG - Intergenic
1198449471 X:136752518-136752540 CTGCTGTGACTGGTTAACTCAGG - Intronic
1201143138 Y:11044917-11044939 ATGCTGTGTCTGTGCAGCACGGG + Intergenic
1202378004 Y:24255636-24255658 CTGCTGCCCCTGGGCCACTCTGG + Intergenic
1202492778 Y:25414485-25414507 CTGCTGCCCCTGGGCCACTCTGG - Intergenic