ID: 1176069086

View in Genome Browser
Species Human (GRCh38)
Location 20:63216668-63216690
Sequence CTTCAGCCGCAGCGGAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176069076_1176069086 23 Left 1176069076 20:63216622-63216644 CCCTTGCCGCGGGACCTGCGGGC No data
Right 1176069086 20:63216668-63216690 CTTCAGCCGCAGCGGAGCCCTGG No data
1176069077_1176069086 22 Left 1176069077 20:63216623-63216645 CCTTGCCGCGGGACCTGCGGGCT No data
Right 1176069086 20:63216668-63216690 CTTCAGCCGCAGCGGAGCCCTGG No data
1176069073_1176069086 29 Left 1176069073 20:63216616-63216638 CCTCGGCCCTTGCCGCGGGACCT No data
Right 1176069086 20:63216668-63216690 CTTCAGCCGCAGCGGAGCCCTGG No data
1176069079_1176069086 9 Left 1176069079 20:63216636-63216658 CCTGCGGGCTTTGTTCGCTTTGC No data
Right 1176069086 20:63216668-63216690 CTTCAGCCGCAGCGGAGCCCTGG No data
1176069078_1176069086 17 Left 1176069078 20:63216628-63216650 CCGCGGGACCTGCGGGCTTTGTT No data
Right 1176069086 20:63216668-63216690 CTTCAGCCGCAGCGGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176069086 Original CRISPR CTTCAGCCGCAGCGGAGCCC TGG Intergenic
No off target data available for this crispr