ID: 1176069151

View in Genome Browser
Species Human (GRCh38)
Location 20:63217001-63217023
Sequence GAGTTAGCCACAAGGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176069151_1176069160 20 Left 1176069151 20:63217001-63217023 CCTGCCACCCTTGTGGCTAACTC No data
Right 1176069160 20:63217044-63217066 GATATTTTTCTTTCCAGCTCTGG No data
1176069151_1176069156 -5 Left 1176069151 20:63217001-63217023 CCTGCCACCCTTGTGGCTAACTC No data
Right 1176069156 20:63217019-63217041 AACTCCCTACAGAGGCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176069151 Original CRISPR GAGTTAGCCACAAGGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr