ID: 1176070530

View in Genome Browser
Species Human (GRCh38)
Location 20:63223970-63223992
Sequence CAGGCTCACCTGGAGGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176070530_1176070536 13 Left 1176070530 20:63223970-63223992 CCTGAAACCTCCAGGTGAGCCTG No data
Right 1176070536 20:63224006-63224028 TGCCTAGCACTCTGCGAGGTTGG No data
1176070530_1176070535 9 Left 1176070530 20:63223970-63223992 CCTGAAACCTCCAGGTGAGCCTG No data
Right 1176070535 20:63224002-63224024 CATGTGCCTAGCACTCTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176070530 Original CRISPR CAGGCTCACCTGGAGGTTTC AGG (reversed) Intergenic
No off target data available for this crispr