ID: 1176070616

View in Genome Browser
Species Human (GRCh38)
Location 20:63224467-63224489
Sequence GTATTAATGGGGAGGGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176070616_1176070627 5 Left 1176070616 20:63224467-63224489 CCTCCCGCCCTCCCCATTAATAC No data
Right 1176070627 20:63224495-63224517 TTCTGTCCATCCCTGGCCCTAGG No data
1176070616_1176070625 -2 Left 1176070616 20:63224467-63224489 CCTCCCGCCCTCCCCATTAATAC No data
Right 1176070625 20:63224488-63224510 ACAGGCCTTCTGTCCATCCCTGG No data
1176070616_1176070628 8 Left 1176070616 20:63224467-63224489 CCTCCCGCCCTCCCCATTAATAC No data
Right 1176070628 20:63224498-63224520 TGTCCATCCCTGGCCCTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176070616 Original CRISPR GTATTAATGGGGAGGGCGGG AGG (reversed) Intergenic
No off target data available for this crispr