ID: 1176072760

View in Genome Browser
Species Human (GRCh38)
Location 20:63235537-63235559
Sequence CTGCGTCACGCAGAGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176072760_1176072770 15 Left 1176072760 20:63235537-63235559 CCTCCCTGCTCTGCGTGACGCAG No data
Right 1176072770 20:63235575-63235597 AGGCTAGAGTCACCCCCGCAAGG No data
1176072760_1176072773 22 Left 1176072760 20:63235537-63235559 CCTCCCTGCTCTGCGTGACGCAG No data
Right 1176072773 20:63235582-63235604 AGTCACCCCCGCAAGGTGGGAGG No data
1176072760_1176072771 18 Left 1176072760 20:63235537-63235559 CCTCCCTGCTCTGCGTGACGCAG No data
Right 1176072771 20:63235578-63235600 CTAGAGTCACCCCCGCAAGGTGG No data
1176072760_1176072776 28 Left 1176072760 20:63235537-63235559 CCTCCCTGCTCTGCGTGACGCAG No data
Right 1176072776 20:63235588-63235610 CCCCGCAAGGTGGGAGGTCACGG No data
1176072760_1176072764 -5 Left 1176072760 20:63235537-63235559 CCTCCCTGCTCTGCGTGACGCAG No data
Right 1176072764 20:63235555-63235577 CGCAGCCCTAGGCCCCTGTGAGG No data
1176072760_1176072772 19 Left 1176072760 20:63235537-63235559 CCTCCCTGCTCTGCGTGACGCAG No data
Right 1176072772 20:63235579-63235601 TAGAGTCACCCCCGCAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176072760 Original CRISPR CTGCGTCACGCAGAGCAGGG AGG (reversed) Intergenic
No off target data available for this crispr